Información

¿Cómo funciona el acoplamiento traslacional en procariotas?

¿Cómo funciona el acoplamiento traslacional en procariotas?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Hoy escuché sobre un fenómeno llamado "acoplamiento traslacional", donde la traducción de una proteína influye en la traducción de otra proteína. Los niveles de ARN mensajero no parecen estar influenciados. ¿Como funciona esto? ¿Necesitan estar en el mismo operón?


El acoplamiento traslacional describe en algunos casos cómo un ARNm codificará a partir de más de una proteína (es decir, será policistrónico). Se cree que el acoplamiento traslacional se usa principalmente como una forma de hacer que un conjunto de genes se traduzcan aproximadamente en la misma cantidad en la célula.

El acoplamiento traslacional es muy común en procariotas y casi la mitad de los genes de e coli se encuentran en un operón policistrónico. Lo que sabemos de ellos es revelador. Existen algunos mecanismos sofisticados para ajustar las proporciones de estos genes adyacentes, que todavía están acoplados, pero con proporciones que no son solo 1: 1. Se muestra que los genes posteriores a menudo se traducen con una frecuencia algo menor porque los primeros genes están disponibles más rápidamente antes de que el ARNm se degrade.

Eric Alm @ MIT escribió este gran artículo sobre cómo evolucionan los operones.

Solo he podido encontrar esta referencia a un caso eucariota de "acoplamiento traslacional" que es muy raro, pero existe. Los casos más comunes de genes acoplados por traducción en eucariotas son los virus de ARN que generalmente contienen solo un ARNm de longitud completa que codifica todos los genes del virus. Las presiones selectivas para mantener el genoma viral pequeño y restringir las proporciones de estos genes harán que estos genes se superpongan incluso, comenzando el siguiente antes de que termine el gen actual.


La respuesta anterior no es del todo precisa. Es cierto que los ARNm policistrónicos (es decir, operones) son muy comunes en las bacterias. Pero esto no es lo que se entiende por acoplado traslacional.

El acoplamiento traslacional ocurre cuando el segundo gen de dos genes adyacentes en un operón, no tiene su propio sitio de unión al ribosoma. En cambio, el ribosoma termina la traducción en un codón de terminación en el primer gen, y luego retrocede levemente y comienza a traducir el codón de inicio del segundo gen. Esto sucede cuando las regiones codificantes de los dos genes se superponen:

P.ej. XXXXXXXXXATGAXXXXXXXXX -la primera serie de X es el final del gen 1 - el TGA es el codón de parada del gen 1 - el ribosoma se desliza hacia atrás un nucleótido y se traduce de ATG - la segunda serie de XXXX es la segunda región de codificación de genes

Se dice que los dos genes están acoplados traduccionalmente porque la interrupción de la traducción del primer gen anularía la traducción del segundo.


Artículo de revisión

  • Departamento de Microbiología y Genética Molecular, Facultad de Medicina, IMRIC, Universidad Hebrea de Jerusalén, Jerusalén, Israel

La transcripción-traducción acoplada (CTT) es un sello distintivo de la expresión génica procariota. La CTT se produce cuando los ribosomas se asocian e inician la traducción de ARNm cuya transcripción aún no ha concluido, por lo que forman complejos & # x201CRNAP.mRNA.ribosome & # x201D. CTT es un fenómeno bien documentado que participa en importantes procesos de regulación de genes, como la atenuación y la polaridad del operón. A pesar del progreso en nuestra comprensión de las señales celulares que coordinan la CTT, ciertos aspectos de su arquitectura molecular siguen siendo controvertidos. Además, la nueva información sobre la segregación espacial entre las maquinarias transcripcionales y de traducción en ciertas especies, y sobre la capacidad de ciertos ARNm para localizar la traducción independientemente, cuestiona la ocurrencia unánime de CTT. Además, los estudios en los que la transcripción y la traducción se desacoplaron artificialmente mostraron que el alargamiento de la transcripción puede proceder de una manera independiente de la traducción. Aquí, revisamos los estudios que apoyan la aparición de CTT y los hallazgos que cuestionan su extensión, así como también discutimos los mecanismos que pueden explicar tanto el acoplamiento como el desacoplamiento, por ejemplo, la reubicación de cromosomas y la participación de elementos que actúan en cis o trans, como ARN pequeños y Proteínas de unión a ARN. Estos mecanismos impactan en la localización, estabilidad y traducción del ARN. Comprender las dos opciones mediante las cuales se pueden expresar los genes y sus consecuencias debería arrojar luz sobre una nueva capa de control del destino de las transcripciones bacterianas.


ALARGAMIENTO

El alargamiento implica ciclos repetitivos de decodificación, formación de enlaces peptídicos y translocación. El alargamiento comienza tan pronto como el segundo codón del ORF se vuelve accesible para lectura por los ARNt-aa elongadores y termina cuando el ribosoma llega al codón de terminación. El mecanismo básico de elongación es muy similar en procariotas y eucariotas (ver Dever et al.2018) y es facilitado por factores de traducción homólogos (EF-Tu / eEF1A, EF-G / eEF2, EF-P / eIF5A, SelB / EFsec) , con algunas adiciones notables, como eEF3, que se encuentra en los hongos.

Descodificación

Durante la decodificación, el ribosoma traduce la secuencia de codones de un ARNm en la secuencia de aminoácidos de una proteína. Un codón expuesto en el sitio A es reconocido por los aa-tRNA, que en las bacterias se entregan al ribosoma en un complejo ternario con EF-Tu y GTP. El reclutamiento inicial del complejo EF-Tu & # x02022GTP / aa-tRNA ocurre a través de interacciones con el tallo bL12 del ribosoma (Kothe et al. 2004 Diaconu et al. 2005). La interacción del anticodón de aa-tRNA con el codón de mRNA en el sitio de decodificación de la SSU desencadena la hidrólisis de GTP por EF-Tu. Después de la liberación de Pi, EF-Tu se reorganiza en la forma unida al difosfato de guanosina (GDP) y libera el aa-tRNA. El aa-tRNA se acomoda en el sitio A de la LSU, mientras que EF-Tu & # x02022GDP se disocia del ribosoma (Rodnina et al. 2017).

Las estructuras de varios intermedios clave de la decodificación, que inicialmente se identificaron mediante estudios bioquímicos y biofísicos, se han determinado mediante microscopía crioelectrónica (crio-EM). Actualmente, una secuencia de instantáneas de decodificación análoga está disponible para EF-Tu & # x02022GTP / Phe-tRNA Phe (Loveland et al. 2017) y SelB & # x02022GTP / Sec-tRNA Sec (Fischer et al. 2016). En contraste con EF-Tu, que es un factor de traducción general que dirige cada elongador aa-tRNA al sitio A, SelB es un factor de elongación especializado que es responsable de la liberación del 21 ° aminoácido proteinogénico natural, selenocisteína (Forchhammer et al. . 1989). Mientras que las dos estructuras crio-EM capturan intermedios algo diferentes en la ruta de decodificación, y algunos detalles parecen específicos para EF-Tu o SelB, la secuencia general de reordenamientos es notablemente similar. Ambos informes (Fischer et al. 2016 Loveland et al. 2017) identifican un intermedio de decodificación temprana en el que el complejo ternario está unido a la SSU, pero el anticodón aún no forma pares de bases con el codón (Fig.2). Estas estructuras tienen una conformación de dominio SSU abierta similar o incluso más abierta que en los ribosomas con un sitio A vacante (Fischer et al. 2016 Loveland et al. 2017). Los residuos de ARNr 16S que forman el núcleo local en el centro de decodificación SSU se alejan del complejo codón & # x02013anticodon, aunque parece haber diferencias sutiles en la orientación de diferentes nucleótidos entre las estructuras EF-Tu y SelB. En ambas estructuras, el residuo clave A1492 está en la forma abierta & # x0201cflipped-out & # x0201d (Ogle et al. 2001) orientada lejos del complejo codon & # x02013anticodon. A1493 está en una orientación semiabierta en el complejo ribosoma & # x02013EF-Tu, pero en una orientación abierta en el complejo SelB también la movilidad de G530 del ARNr 26S parece diferir entre los dos complejos (Fischer et al. 2016 Loveland et al. .2017).

Mecanismo estructural de decodificación visualizado por microscopía crioelectrónica (crio-EM). (Cima) Intermedios de decodificación análoga por factor de alargamiento (EF) -Tu & # x02022GDP & # x02013Phe-tRNA Phe. (Izquierda) Esquema de la interacción del codón análogo & # x02013anticodon entre el codón de ARNm de UUC y el anticodón de AAG de Phe-tRNA Phe. Otros paneles muestran los intermedios de decodificación del estado T antes de la lectura del codón, A * / T, donde el codón ha sido reconocido pero EF-Tu no se movió al bucle sarcina-ricina (SRL) del estado SSU y A / T con la interacción correcta entre el codón y el anticodón y EF-Tu acoplado en la SRL. Recuadros sobre cima muestran la orientación del dominio G de EF-Tu en relación con el SRL. GCP, GDPCP análogo de GTP no hidrolizable. Recuadros en el fondo muestran el complejo codon & # x02013anticodon y los residuos clave del ARN ribosómico 16S (ARNr) que interactúan con él. (Medio) Lo mismo que el anterior para un par casi análogo con un solo desajuste G & # x02013U en la segunda posición del complejo codón & # x02013anticodon. (Fondo) Intermedios de decodificación análoga por SelB & # x02022GDPNP / Sec-tRNA Sec. GNP, análogo de GTP no hidrolizable GDPNP IB, unión inicial antes de la lectura del codón CR, complejo de lectura de codón en el que el anticodón del ARNt se acerca al codón, pero antes del emparejamiento de bases GA, complejo activado por GTPasa análogo al A / Estado T. (La figura se preparó utilizando coordenadas de estructura de Fischer et al.2016 y Loveland et al.2017, PDB 5UYK, 5UYL, 5UYM, 5UYN, 5UYP, 5UYQ, 5LZB, 5LZC y 5LZD.)

El segundo intermedio del complejo SelB captura un estado de decodificación temprano en el que solo se forma un único par de bases potenciales entre el codón y el anticodón, mientras que en el complejo EF-Tu-enlazado, el anticodón está completamente emparejado con el codón en ambos casos, el ribosoma permanece en una conformación abierta. En el complejo EF-Tu, el bolsillo de unión a GTP permanece distante de la LSU (Loveland et al.2017) y, por lo tanto, la actividad GTPasa de EF-Tu, que requiere una interacción de EF-Tu con el bucle sarcina-ricina ( SRL) del ARNr 23S como elemento activador de GTPasa, permanece bajo (Maracci et al. 2014). A diferencia de EF-Tu, SelB interactúa con LSU en ambos intermedios antes del reconocimiento del codón, pero el contacto con el SRL es bloqueado por Sec-tRNA Sec (Fischer et al. 2016). Curiosamente, se identificó una interacción protectora similar de aa-tRNA con SRL entre los intermedios de decodificación de la traducción eucariota, donde bloquea el acceso de eEF1A al centro de activación de GTPasa (Budkevich et al. 2014).

Una vez que se ha establecido la interacción del codón & # x02013anticodon, los residuos de rRNA 16S en el centro de decodificación cambian su orientación a la conformación & # x0201cflipped-in & # x0201d (Ogle et al. 2001) y se cierran en el complejo del codon & # x02013anticodon (Fischer et al. .2016 Loveland et al.2017), consistente con los reordenamientos locales inferidos de las comparaciones de estructuras SSU con o sin bucles de tallo anticodón (ASL) del tRNA del sitio A (Ogle et al. 2001). En el complejo EF-Tu, G530 parece actuar como un pestillo que sujeta la hélice del codón & # x02013anticodon en el centro de decodificación. El cierre local del centro de decodificación coincide con el cierre del dominio SSU, que arrastra el tRNA y EF-Tu hacia el SRL. La magnitud de los cambios conformacionales que tienen lugar en el cierre del dominio (Fischer et al. 2016) parece ser incluso mayor que los reportados previamente para el complejo SSU & # x02013ASL (Ogle et al. 2001). El aa-tRNA se distorsiona en el reconocimiento de codones (Valle et al. 2003 Schmeing et al. 2009 Schmeing et al. 2011 Fischer et al. 2016 Loveland et al. 2017). En solución, el tRNA puede adoptar tales conformaciones de tRNA distorsionadas de forma espontánea en menos de un microsegundo (Fischer et al. 2016). El ribosoma parece estabilizar subconjuntos específicos de conformaciones en un estado dado, dependiendo de las interacciones en el centro de decodificación. El acoplamiento del dominio G de EF-Tu activa la hidrólisis de GTP, el paso irreversible que separa la selección inicial del paso de corrección de pruebas posterior.

La hidrólisis de GTP en EF-Tu y otras GTPasas traslacionales se basa en el residuo His universalmente conservado (His84 en E. coli EF-Tu) en la región Switch II y en el residuo Asp conservado (Asp21 en EF-Tu) en el bucle P (Maracci et al. 2014). El SRL de LSU actúa como activador de GTPasa (Wool et al. 1992 Schmeing et al. 2009). La interacción de la SRL con His84 desplaza la pKa valor de His84 de tal manera que la cadena lateral se cargue positivamente a pH neutro y posicione la molécula de agua nucleofílica para el ataque al & # x003b3-fosfato de GTP (Adamczyk y Warshel 2011 Wallin et al. 2013 Aqvist y Kamerlin 2015) . Las simulaciones por computadora favorecen el mecanismo de reacción con una transferencia temprana de protones desde el agua al & # x003b3-fosfato, seguida de un ataque nucleófilo por un ion hidróxido, un escenario que parece ser consistente con la falta de dependencia del pH de la hidrólisis de GTP en casi pH neutro y un efecto isotópico de solvente cinético insignificante (Maracci et al. 2014). El Asp21 conservado complejado con Mg 2+ puede contribuir a la aceleración de la hidrólisis de GTP al & # x0201cpushing & # x0201d la carga negativa hacia His84 (Aqvist y Kamerlin 2015). Por lo tanto, la hidrólisis de GTP se rige principalmente por la electrostática del centro de reacción (Adamczyk y Warshel 2011 Prasad et al. 2013 Maracci et al. 2014 Aqvist y Kamerlin 2015). Además, la proteína ribosómica bL12 contribuye a la activación de la GTPasa a través de un mecanismo aún no determinado (Mohr et al. 2002 Diaconu et al. 2005). Es probable que el mecanismo de hidrólisis de GTP se conserve en todas las GTPasas de traducción, como EF-Tu, EF-G, SelB, IF2 y RF3 y sus homólogos eucariotas.

Durante la decodificación, el ribosoma tiene que seleccionar un aa-tRNA afín al codón dado del conjunto de diferentes aa-tRNA. La fidelidad de la selección de aa-tRNA es alta, con frecuencias de error de 10 & # x022123 o menos (Drummond y Wilke 2009). Una cuestión importante sin resolver es cómo responde el ribosoma a los desajustes de codones y anticodon. El primer modelo basado en la comparación de los complejos de ARNm 30S & # x02013 con ASL afines o casi afines sugirió que los desajustes perturban el cierre del dominio SSU (Ogle et al. 2002). Sin embargo, las estructuras cristalinas de alta resolución de los complejos ribosoma & # x02013mRNA & # x02013tRNA no afines o casi análogos mostraron una disposición local y global idéntica de la SSU (Demeshkina et al.2012 Rozov et al.2015, 2016a, b). De manera similar, en la estructura crio-EM, casi afines EF-Tu & # x02022GTP / Lys-tRNA (anticodón UUU, que hace que una segunda posición no coincida con el codón AGA) indujo los mismos cambios conformacionales locales y globales que EF-Tu & # x02022GTP / Phe-tRNA Phe en el codón UUC afín (Loveland et al.2017). Sin embargo, solo una pequeña parte de los complejos ternarios casi afines adopta el estado activado por GTPasa, mientras que la mayoría se rechaza en la etapa de selección inicial antes de la hidrólisis de GTP (Rodnina et al. 2017). Por tanto, es posible que las estructuras disponibles de los complejos casi afines proporcionen instantáneas de los errores de traducción, en lugar de los intermedios de decodificación habituales. Los complejos visualizados representan aquellos que pasaron las pantallas de selección del ribosoma y darán como resultado la incorporación de un aminoácido incorrecto en la proteína. Por el contrario, las estructuras de la mayoría rechazada de complejos casi afines pueden ser similares a las de los complejos antes del emparejamiento de codón y anticodón. En particular, tales complejos deben ser incluso menos estables que los intermedios de reconocimiento de pre-codones de los complejos afines, ya que parecen demasiado transitorios para ser capturados por cristalografía o crio-EM. Se debe enfatizar que las estructuras de complejos casi afines son extremadamente valiosas, ya que muestran cómo la tautomerización o la presencia de modificaciones de tRNA ayudan a los complejos mal emparejados a adoptar la geometría que el ribosoma reconoce como correcta.

Después de la hidrólisis de GTP y una liberación de Pi ligeramente retrasada (Kothe y Rodnina 2006), EF-Tu se reorganiza en la conformación unida a GDP. Las simulaciones de dinámica molecular sugirieron que esto puede impulsar el extremo 3 & # x02032 del aa-tRNA hacia el sitio A en la LSU en una posición donde el codo del tRNA interactúa con H89 de la LSU (Noel y Whitford 2016). El Aa-tRNA puede fluctuar entre los dos estados conformacionales hasta que se libera EF-Tu. La acomodación del extremo del ARNt 3 & # x02032 en el sitio A constituye un paso separado (Geggier et al. 2010). Esta noción está respaldada por datos bioquímicos recientes (Ieong et al. 2016 Ranjan y Rodnina 2017), aunque los dos pasos no se resuelven cinéticamente para cada tRNA. La acomodación es más lenta para los casi afines, en comparación con los aa-tRNA afines, lo que brinda una segunda oportunidad para rechazar un tRNA con desajustes en el complejo codón & # x02013anticodon en la etapa de corrección de pruebas (Rodnina et al. 2017).

Formación de enlaces peptídicos

En el centro de la peptidil transferasa del ribosoma, el peptidil-tRNA en el sitio P y el aa-tRNA en el sitio A reaccionan para formar un enlace peptídico. En comparación con la reacción entre los sustratos del modelo en solución, la reacción en el ribosoma se acelera aproximadamente 10 7 veces (Sievers et al. 2004). El sitio activo del ribosoma está compuesto por ARNr (Ban et al. 2000 Polikanov et al. 2014) y, por lo tanto, el ribosoma es el catalizador de ARN más grande conocido y la única ribozima natural conocida que tiene actividad polimerasa. A diferencia de las enzimas proteicas, el ribosoma no proporciona grupos catalíticos con pKa valores a pH neutro (Youngman et al. 2004 Bieling et al. 2006). La catálisis es principalmente entrópica (Sievers et al. 2004). El ribosoma facilita la reacción ordenando las moléculas de agua, colocando los residuos de ARNr y ARNt y protegiendo electrostáticamente (Sharma et al. 2005 Wallin y Aqvist 2010).

La formación de enlaces peptídicos se produce mediante el ataque nucleofílico del grupo amino de aa-tRNA sobre el carbono carbonilo del enlace éster en peptidil-tRNA. En solución, se espera que la reacción tenga dos intermedios, un intermedio tetraédrico zwiteriónico (T & # x000b1), que se desprotona y forma un segundo intermedio (T & # x02212), y luego se descompone para formar los productos de reacción (Satterthwait y Jencks 1974). Un análisis exhaustivo de los efectos de los isótopos cinéticos de los átomos pesados ​​indicó que el ribosoma altera la vía de reacción de tal manera que el intermedio T & # x000b1 ya no se acumula. La transferencia de protones del nitrógeno atacante y la formación del intermedio tetraédrico tienen lugar durante el paso limitante de la velocidad, mientras que la ruptura del intermedio tetraédrico ocurre en un paso rápido separado (Hiller et al. 2011). El análisis de los efectos isotópicos del disolvente cinético mostró que en el estado de transición limitante de la velocidad, tres protones se mueven de manera concertada (Kuhlenkoetter et al. 2011).En particular, hay varias moléculas de agua dentro del centro de la peptidil transferasa que pueden intercambiar protones (Polikanov et al. 2014). También el grupo 2 & # x02032OH de A76 del tRNA del sitio P (Zaher et al. 2011) y el 2 & # x02032OH de A2451 del rRNA 23S (Erlacher et al. 2006) contribuyen a la transferencia de protones y / o estabilizan las cargas que se desarrollan como la reacción prosigue.

Actualmente existen dos modelos que explican el movimiento de protones en el sitio activo durante la formación de enlaces peptídicos (Fig. 3). Un modelo, denominado lanzadera de protones de ocho miembros (Wallin y Aqvist 2010), sugiere que el ataque del grupo & # x003b1-amino en el carbono del carbonilo del éster da como resultado un estado de transición de ocho miembros en el que un protón del El grupo & # x003b1-amino es recibido por el grupo 2 & # x02032OH de A76, que al mismo tiempo dona su protón al oxígeno del carbonilo a través de una molécula de agua adyacente (Kuhlenkoetter et al. 2011). La protonación del 3 & # x02032OH es un paso rápido independiente. El modelo alternativo, denominado modelo & # x0201cproton wire & # x0201d, sugiere que una de las moléculas de agua que residen en el centro de la peptidil transferasa está parcialmente cargada negativamente por la vecindad del grupo amino-terminal desprotonado & # x003b1-amino del ribosomal proteína bL27 y del oxígeno 5 & # x02032-fosfato cargado negativamente del sitio A A76 (Polikanov et al. 2014). Tras la formación de un intermedio tetraédrico, las cargas positivas y negativas emergentes pueden separarse en el espacio y deslocalizarse sobre las bolsas que contienen moléculas de agua. Los dos modelos tienen en cuenta los tres protones que se mueven de manera concertada en el estado de transición que limita la velocidad, pero no están de acuerdo con la ruta exacta de transferencia de protones. Un argumento en contra del modelo de alambre de protones (Polikanov et al. 2014) es que la deleción de bL27 no tiene ningún efecto sobre la formación de enlaces peptídicos (Maracci et al. 2015). Además, el papel del 2 & # x02032OH de A2451 del rRNA 23S, que juega un papel esencial en el modelo de alambre de protones, no se ha probado en condiciones de formación rápida de enlaces peptídicos (Erlacher et al. 2006). Por otro lado, el modelo de lanzadera de protones tiene una estereoquímica menos óptima que el modelo de alambre de protones (Polikanov et al. 2014).

Modelos de transferencia de protones durante la formación de enlaces peptídicos. Se muestran esquemas de reacción para los mecanismos de lanzadera de protones y alambre de protones de ocho miembros. El ARNt del sitio P se muestra en verde, el ARNt del sitio A en azul y el 2 & # x02032OH de A2451 en negro. El ataque nucleofílico está representado por flechas rojas. En la lanzadera de protones de ocho miembros, el ataque del grupo & # x003b1-amino sobre el carbono del carbonilo del éster da como resultado un estado de transición limitante de la velocidad de ocho miembros en el que el grupo & # x003b1-amino recibe un protón del grupo & # x003b1-amino. 2 & # x02032OH grupo de A76, que al mismo tiempo dona su protón al oxígeno del carbonilo a través de una molécula de agua adyacente (Kuhlenkoetter et al. 2011). En el modelo de alambre de protones, el protón del grupo & # x003b1-amino es recibido por el grupo 2 & # x02032OH de A76, que a su vez dona un protón al 2 & # x02032OH de A2451, y luego a una molécula de agua (W1). , que está parcialmente cargada negativamente (Polikanov et al. 2014). Ambos modelos explican el movimiento concertado de tres protones en el estado de transición que limita la velocidad (Kuhlenkoetter et al. 2011). (De Polikanov et al.2014 adaptado, con permiso, de Nature Publishing Group bajo una licencia Creative Commons.)

Las reactividades de los aminoácidos naturales en la reacción de la peptidil transferasa difieren sustancialmente (Wohlgemuth et al. 2008). Sin embargo, el ribosoma puede producir péptidos con la mayoría de las combinaciones de aminoácidos sin la ayuda de ningún factor auxiliar adicional. Una excepción notable es la síntesis de tramos de poli-Pro con tres o más prolina consecutivas o de distintas secuencias XPPX con dos prolinas flanqueadas por aminoácidos específicos (Hersch et al. 2013 Peil et al. 2013 Woolstenhulme et al. 2013). Durante la síntesis de tales péptidos, el ribosoma se detiene debido a una baja tasa de formación de enlaces peptídicos (por ejemplo, para el motivo PPP, el ribosoma se detiene después de la incorporación del segundo Pro) (Ude et al. 2013). El estancamiento se alivia con EF-P (Doerfel et al. 2013 Ude et al. 2013), un factor de traducción especializado que ingresa al sitio E del ribosoma y actúa mediante la dirección entrópica de los sustratos del sitio P y A hacia sus sustratos catalíticos. orientación productiva en el centro de la peptidil transferasa (Fig.4) (Doerfel et al.2015 Huter et al.2017). El homólogo eucariota de EF-P, eIF5A, también acelera la formación de cadenas poli-Pro (Gutiérrez et al. 2013). eIF5A parece tener funciones adicionales en elongación y terminación (Schuller et al.2017 ver también Dever et al.2018). EF-P no tiene una funcionalidad tan amplia, porque EF-P reconoce el tRNA en el sitio P y favorece las interacciones con tRNA Pro y tRNA fMet, pero es considerablemente menos activo con otros tRNAs (Katoh et al. 2016).

Acción del factor de alargamiento P (EF-P) en los ribosomas estancados en tramos de poliprolina. (A) Los ribosomas se detienen durante la traducción de proteínas que contienen tres prolina consecutivas (estrellas rojas). La unión del peptidil-tRNA (verde) al sitio P se desestabiliza, lo que (B) puede conducir a la caída del peptidil-tRNA. (C) El todo-trans o todo-cis Las conformaciones de poliprolina de la cadena naciente no son posibles debido a un choque estérico con G2061 (gris) dentro de la pared del túnel. El peptidil-tRNA se desestabiliza y evita la acomodación del tRNA del sitio A (naranja) y la formación de enlaces peptídicos. (D) Los ribosomas estancados en tramos de poliprolina son reconocidos por EF-P (rosa), que se une dentro de la región del sitio E y estabiliza el peptidil-tRNA. La unión de EF-P se facilita mediante contactos con el tallo L1 y el ARNt del sitio P, así como con el codón del sitio E. (mi) La interacción de & # x003b5 (R) - & # x003b2-lisil-hidroxilisina con el extremo CCA del ARNt del sitio P Pro estabiliza el ARNt del sitio P así como la cadena naciente, obligando a las prolina a adoptar una alternativa conformación que pasa al túnel de salida ribosomal. (FPor tanto, se logra una geometría óptima entre la cadena naciente y el aminoacil-tRNA en el sitio A y puede producirse la formación de enlaces peptídicos. (De Huter et al.2017 adaptado, con autorización, de Elsevier & # x000a9 2017.)

EF-P y eIF5A se modifican postraduccionalmente (para una revisión, ver Lassak et al. 2016). La modificación es esencial para la función (Doerfel et al. 2013 Gutierrez et al. 2013 Ude et al. 2013), pero varía entre diferentes grupos de bacterias y eucariotas. En E. coli, Lys34 de EF-P se modifica postraduccionalmente a una lisil-lisina (Yanagisawa et al. 2010). En Pseudomonas aeruginosa y Shewanella oneidensis Arg32 (que ocupa la posición de E. coli Lys34) está ramnosilado (Lassak et al.2015), mientras que EF-P de Bacillus subtilis lleva un resto de 5-aminopentanol unido a Lys32 (Rajkovic et al. 2016). En eucariotas, el residuo de lisina conservado de eIF5A se modifica a hipusina (Cooper et al. 1983).

Translocación

Después de la formación del enlace peptídico, las subunidades ribosómicas se mueven entre sí, desde el estado no rotado (N) con los dos ARNt unidos a los sitios P ​​y A tanto en la SSU como en la LSU, al estado rotado (R) con los ARNt unidos en estados híbridos P / E y A / P. Al mismo tiempo, el tallo de uL1 se mueve de una conformación abierta a una cerrada hacia el ARNt del sitio P (para una revisión, ver Frank y González 2010). Los ribosomas en el estado de pretranslocación (PRE) fluctúan entre los estados N y R. Las simulaciones de dinámica molecular sugieren que la rotación de los ribosomas y el movimiento interno concomitante de los dominios de la cabeza y el cuerpo de la SSU (denominado giro de la cabeza) son intrínsecamente muy rápidos y pueden ocurrir en una escala de tiempo de microsegundos (Bock et al. 2013). Sin embargo, la translocación del tRNA no ocurre espontáneamente porque las interacciones de los dos tRNA con el ribosoma restringen el movimiento. En el estado de postranslocación (POST), los ribosomas se encuentran predominantemente en el estado N con ARNt en sus posiciones clásicas.

EF-G promueve la translocación a costa de la hidrólisis de GTP. El movimiento de los ARNt y el ARNm durante la translocación es un proceso de varios pasos (Fig. 5). Los modelos actuales distinguen hasta ocho pasos discretos basados ​​en información estructural, así como en estudios cinéticos de conjunto y de una sola molécula utilizando una gran variedad de indicadores de fluorescencia y pares de transferencia de energía de resonancia de fluorescencia (FRET) (Guo y Noller 2012 Adio et al.2015 Belardinelli et al. al.2016a Sharma et al.2016b Wasserman et al.2016). Además de los estados PRE y POST, el ribosoma puede adoptar varias conformaciones intermedias que difieren en las posiciones de los ARNt con respecto a los dominios de cabeza y cuerpo de SSU y los bucles de sitios A y P en LSU. Las posiciones del ARNt se correlacionan con el grado de rotación de la subunidad y el giro del dominio de la cabeza SSU. Estos estados se conocen como estados quiméricos (CHI) (p. Ej., Ap / P y pe / E [Ramrath et al. 2013] ap / ap [Zhou et al. 2014] o estados no canónicos identificados por smFRET [Chen et al. 2011 Adio et al. 2015 Wasserman et al. 2016]).

Modelo cinético de translocación. Los estados de rotación de la subunidad pequeña (SSU) en relación con la subunidad grande (LSU) (gris) se indican mediante la intensidad del color del cuerpo SSU (azul claro para no rotado, N azul oscuro para rotado, R). Los movimientos giratorios de la cabeza de la SSU están representados por un gradiente de color que va del verde claro (posición clásica de la cabeza de la SSU sin girar) a verde bosque (grado máximo de giro del dominio de la cabeza de la SSU en relación con el dominio del cuerpo de la SSU) (Belardinelli et al. 2016a). El ARNt peptidilo y desacilado en el complejo del estado de pretranslocación (PRE) se muestran en magenta y azul, respectivamente. EF-G (violeta) se muestra en dos conformaciones, una compacta (Lin et al. 2015) y una extendida después del compromiso con el ribosoma (Ramrath et al. 2013 Zhou et al. 2014). Las tasas de transición entre PRE (N) y PRE (R) y PRE (N) & # x02013EF-G y PRE (R) & # x02013EF-G (kCW y kCCW a 37 & # x000b0C) se modifican a partir de los datos de Sharma et al. (2016b). Las constantes de velocidad para los pasos 1, 2, 3, 4 y 5 definidos cinéticamente son de estudios de cinética de conjuntos a 37 & # x000b0C (Belardinelli et al. 2016a). Paso 1, unión EF-G. Paso 2, hidrólisis de GTP (Rodnina et al. 1997 Savelsbergh et al. 2003) y apertura de SSU debido a los movimientos opuestos de los dominios de cabeza y cuerpo de SSU (ver recuadro) (Belardinelli et al. 2016a). Paso 3, desbloqueo del complejo tRNA & # x02013mRNA en la SSU, que limita la velocidad del movimiento del tRNA y la liberación de Pi de EF-G (Savelsbergh et al. 2003). Se demostró la existencia de transiciones rápidas entre los pasos 3 y 4 utilizando intermediarios de translocación estancados (Savelsbergh et al. 2003 Holtkamp et al. 2014). Los intermedios de translocación (CHI1 a CHI4) se adoptan a partir de datos smFRET (Adio et al. 2015). El estado de postranslocación (POST) puede implicar más subestados conformacionales (Wasserman et al. 2016). El fondo rojo claro indica complejos en proceso de desbloqueo, el fondo verde claro muestra complejos que se mueven hacia el desbloqueo. (Recuadro) Tiempos distintos de los movimientos en sentido antihorario (CCW) y en sentido horario (CW) del cuerpo de la SSU en relación con la LSU (símbolos azules) y de la cabeza de la SSU (símbolos verdes) (Belardinelli et al. 2016a). (De Belardinelli et al. 2016b con permiso de Taylor & # x00026 Francis y Creative Commons Public Domain Licensing.)

Después de la unión de EF-G al ribosoma, los dominios de la cabeza y el cuerpo de la SSU se mueven en la misma dirección en sentido antihorario (CCW) en relación con la LSU, que se denomina hacia adelante, porque corresponde con la dirección de translocación (Fig.5) ( Guo y Noller 2012 Belardinelli et al.2016b Wasserman et al.2016). EF-G hidroliza GTP, pero retiene el Pi (Savelsbergh et al. 2003, 2005). Luego, el cuerpo de la SSU comienza a moverse hacia atrás en el sentido de las agujas del reloj (CW), mientras que la cabeza de la SSU permanece en el estado girado hacia adelante (Guo y Noller 2012 Belardinelli et al. 2016b Wasserman et al. 2016). Esto puede abrir la región de decodificación lo suficiente como para desacoplar los ARNt de las interacciones con los elementos del ribosoma que mantienen el ARNm y los anticodones del ARNt en el sitio A y P, respectivamente. Esto explica cómo se forman los estados CHI: mientras se retienen las posiciones del ARNt en el dominio principal de la SSU, el cuerpo de la SSU se mueve, lo que lleva al desplazamiento de los ARNt a los estados CHI.

Después del desbloqueo de los complejos de codón & # x02013anticodon de la SSU, el dominio principal de SSU comienza a moverse hacia atrás (Guo y Noller 2012 Belardinelli et al. 2016b Wasserman et al. 2016). Los ARNt adoptan sus posiciones POST canónicas en los sitios P ​​y E y EF-G libera Pi (Savelsbergh et al. 2003). A continuación, el tRNA del sitio E se aleja más del tRNA del sitio P, lo que se acompaña de la pérdida del codón del sitio E y la interacción del anticodon, mientras que la cabeza de la SSU se mueve más hacia atrás (Adio et al.2015 Belardinelli et al. 2016a). Finalmente, la disociación del ARNt del sitio E y EF-G restaura el estado N con una posición clásica P / P del peptidil-ARNt. El papel de EF-G es acelerar y estabilizar el estado R del ribosoma, desbloquear el complejo tRNA & # x02013mRNA de la SSU y asegurar el movimiento hacia adelante de los tRNA insertando el dominio 4 EF-G en el sitio A en la SSU. En otras palabras, EF-G actúa como un trinquete para rectificar los movimientos brownianos del ribosoma en un movimiento dirigido y promueve un reordenamiento conformacional clave de la SSU que interrumpe sus interacciones con los tRNA, lo que permite una rápida translocación del tRNA (para una revisión, ver Belardinelli et al.2016b).

Translocación y recodificación

Mientras se mueve a lo largo del ARNm, el ribosoma puede encontrar estructuras como vástagos o pseudonudos. En la mayoría de los casos, la helicasa ribosómica compuesta por proteínas ribosomales uS3, uS4 y uS5 asegura el desenrollamiento del ARNm mediante una combinación de mecanismos helicasa activos y pasivos (Takyar et al. 2005 Qu et al. 2011). Sin embargo, los elementos de la estructura secundaria del ARNm en combinación con secuencias resbaladizas pueden conducir a un desplazamiento del marco de lectura & # x020131. Los sitios deslizantes son secuencias de ARNm donde los codones en el marco 0 y & # x020131 codifican para los mismos ARNt. La cinética de conjuntos y los estudios de una sola molécula indican que & # x020131 cambio de marco en el ARNm que codifica la proteína 1a / 1b del virus de la bronquitis infecciosa (IBV) (que funciona in vivo en sistemas eucariotas y bacterianos [Napthine et al. 2003]) o DnaX de E. coli ocurre durante la translocación de dos ARNt unidos a los codones del sitio resbaladizo (Caliskan et al. 2014 Chen et al. 2014 Kim et al. 2014 Yan et al. 2015). La recodificación en eucariotas se describe en Dever et al. (2018). El elemento de estructura secundaria perturba la dinámica de los ribosomas durante la translocación. Mientras que los primeros pasos de la translocación avanzan con una eficiencia imperturbable, el giro hacia atrás del dominio de la cabeza SSU se ve impedido por el obstáculo de la estructura en el ARNm (Caliskan et al. 2014 Kim et al. 2014). Los ribosomas que están bloqueados en un estado desbloqueado son aparentemente menos estrictos para mantener el marco de lectura y pueden deslizarse en la dirección & # x020131.

Plegamiento de proteínas cotraduccionales

Durante el alargamiento, el péptido naciente se mueve a través del túnel de salida del polipéptido del ribosoma, que se extiende desde el centro de la peptidiltransferasa hasta la superficie citoplasmática de la LSU (Fig. 6). El túnel de salida tiene aproximadamente 100 & # x000c5 de largo y puede acomodar 30 o más aminoácidos, dependiendo de la estructura del péptido, antes de que la cadena naciente emerja del ribosoma. Las proteínas nacientes emergentes pueden comenzar a plegarse dentro del túnel, que puede acomodar elementos de estructura secundaria o incluso dominios pequeños (para revisiones, ver Balchin et al.2016 Rodnina 2016 Thommen et al.2017). Mientras viaja a través del túnel de salida, el péptido puede adoptar una estructura compacta no nativa, que se reordena a una forma nativa cuando todo el dominio emerge del puerto de salida (Holtkamp et al. 2015). El ribosoma afecta el plegamiento de proteínas imponiendo una vía de plegado vectorial y acoplando el plegado al ritmo de traducción. Los eventos de plegamiento iniciales están restringidos por el espacio confinado dentro del túnel de salida y además se modulan mediante interacciones entre el péptido que emerge del túnel de salida y la superficie de la LSU. La relación entre la velocidad de traducción y la dirección del plegamiento de proteínas es bastante compleja. La presencia de codones raros en el ARNm ralentiza la traducción, altera la cinética del plegamiento cotraduccional y cambia la distribución de las conformaciones de proteínas en el conjunto de proteínas maduras resultante (Clarke y Clark 2008 Tsai et al. 2008 Zhang et al. 2009 Siller et al. .2010 Spencer et al.2012 Yu et al.2015 Buhr et al.2016 Sharma et al.2016a). El modelado informático sugiere que los cambios en la tasa de traducción pueden coordinar las tasas de plegado locales e inducir o prevenir el plegado incorrecto (O & # x02019Brien et al. 2014 Trovato y O & # x02019Brien 2017). El plegamiento de proteínas cotraduccionales también se ve afectado por las proteínas que se unen en las proximidades del puerto de salida, como el factor desencadenante chaperón (Gloge et al. 2014 Balchin et al. 2016).

Plegamiento de proteínas cotraduccionales. Las llamadas resumen los efectos potenciales en cada paso (Rodnina 2016). U, estado C desplegado, estado transitorio compacto o N intermedio plegable, plegado nativo.


Procesos cotranscripcionales y características transcriptómicas que afectan el acoplamiento transcripción-traducción en arqueas

Las estructuras del expresoma ilustran la interacción altamente coordinada de dos maquinarias moleculares. Sin embargo, el expresoma no es un complejo aislado, sino que opera con alta especificidad en un citoplasma abarrotado donde ocurren miles de procesos moleculares simultáneamente. En las arqueas, se han identificado una serie de pasos transcripcionales y cotranscripcionales que podrían prevenir la carga inmediata del ribosoma en el ARNm. Entre otros, procesos como el procesamiento de ARN co-transcripcional, la unión de ARN no codificantes (ncRNA) y la asociación de chaperonas de ARN y factores de terminación de la transcripción con el ARN pueden influir en la formación del expresoma y se discutirán brevemente en esta sección (comparar las Figuras 2G y # x02013 I).

El acoplamiento del ribosoma a RNAP requiere que el mRNA abarque la distancia entre el sitio activo de RNAP y el sitio P ribosómico para proporcionar suficiente espacio para ambas maquinarias (Figura 2G). Normalmente, las secuencias reguladoras que confieren el inicio de la traducción se codifican en la región no traducida 5 '(5'-UTR). Algunos ARNm de arqueas tienen un UTR corto de 5 'o ninguno en absoluto (analizado para Haloferax volcanii, Thermococcus onnurineus, Pyrococcus abyssi, Saccharolobus solfataricus, Heyer et al., 2012 Xu et al., 2012 Beck y Moll, 2018). El número relativo de ARNm sin líder oscila entre el 1,4 y el 72%. El mecanismo de reconocimiento de ARNm y asociación de ribosomas parece ser muy diverso en procariotas, y no sabemos si el mecanismo de iniciación influye y se correlaciona con la formación del expresoma (Wen et al., 2020). Los ARNm que carecen de un sitio de unión ribosómico (RBS) también pueden surgir de eventos de procesamiento de ARN en el extremo 5 'que conducen a la escisión del 5'-UTR (Qi et al., 2017 Figura 2G). Como se muestra para varias bacterias (M & # x000e4der et al., 2004 Ramirez-Pe & # x000f1a et al., 2010 Lioliou et al., 2012) y para los organismos arqueales Methanocaldococcus jannaschii y Marinobacter psychrophilus (Zhang y Olsen, 2009 Qi et al., 2017), el procesamiento de los ARNm puede estabilizar las transcripciones y regular la traducción de proteínas r (Qi et al., 2017) y ARNm de operones multicistrónicos. En este caso, la sincronización del procesamiento y la traducción del ARNm parece importante para evitar conflictos entre estos dos procesos.

La unión cotranscripcional de un ncRNA regulador pequeño a un mRNA es un mecanismo de regulación postranscripcional común en procariotas que influye en la estabilidad del RNA y la eficiencia de traducción de los mRNA en respuesta a las condiciones ambientales cambiantes (Babski et al., 2014 H & # x000f6r et al., 2018 ). Para H. volcanii y Methanosarcina mazei Se han detectado pequeños ncRNA que pueden unirse potencialmente a la UTR 5 'enmascarando potencialmente el RBS (J & # x000e4ger et al., 2009 Soppa et al., 2009 Heyer et al., 2012 Gelsinger y DiRuggiero, 2018 Figura 2H). Por ejemplo, el ARN pequeño41 en M. mazei une múltiples RBS en un ARNm policistrónico y desacopla la transcripción y la traducción (Buddeweg et al., 2018).

En las bacterias, la hibridación ncRNA-mRNA a menudo está mediada por la chaperona de RNA Hfq, que pertenece a la familia de proteínas Sm (Vogel y Luisi, 2011). Hfq puede unirse al ARN cotranscripcionalmente (Kambara et al., 2018) y desempeña un papel en la terminación / antiterminación de la transcripción (Rabhi et al., 2011 Sedlyarova et al., 2016), la biogénesis del ribosoma (Andrade et al., 2018) y asociación del ribosoma con el ARNm en bacterias (Chen et al., 2019). En arqueas, un De buena fe La proteína Hfq rara vez se codifica. Con mayor frecuencia, genes únicos o múltiples codifican una proteína similar a Sm de arqueas (SmAP Reichelt et al., 2018). Al igual que el Hfq bacteriano, se demostró que los SmAP de arqueas se unen a los ARN (Nielsen et al., 2007 Fischer et al., 2010 M & # x000e4rtens et al., 2015). Por lo tanto, la asociación cotranscripcional de un ncRNA en la UTR 5 '(potencialmente respaldada por un SmAP) evitaría la asociación de ribosomas con la UTR 5' (Figura 2H). Los experimentos de co-inmunoprecipitación mostraron que los SmAP no solo se unen a los ARN sino también a las proteínas r (Fischer et al., 2010). Es concebible que los SmAP participen en la regulación, traducción postranscripcional o actúen como un factor puente para reclutar ribosomas en el ARNm (Figura 2H).

Por último, la vía de terminación de la transcripción podría ser decisiva si puede ocurrir TTC o viceversa (Figura 2I). En arqueas, la transcripción termina vía dos mecanismos que no son necesariamente mutuamente excluyentes: (i) terminación intrínseca en tramos poli (U) (Santangelo y Reeve, 2006 Hirtreiter et al., 2009, 2010 Santangelo et al., 2009 Dar et al., 2016 Berkemer et al. , 2020) o (ii) terminación dependiente del factor asistida por el factor de terminación de arquea aCPSF1 / FttA que se une al ARN naciente (Sanders et al., 2020 Yue et al., 2020). Es importante destacar que aCPSF1 también mejora la terminación en tramos poli (U). Terminación vía aCSPF1 implica la escisión del transcrito en el extremo 3 '. En Methanococcus maripaludis la deleción de aCPSF1 dio como resultado niveles de expresión alterados para la mayoría de genes (Yue et al., 2020). Además, la terminación dependiente de aCPSF1 se estimula por la presencia del dominio del tallo y Spt4 / 5 (Sanders et al., 2020). Aunque aún no se ha verificado experimentalmente una interacción directa entre aCPSF1 y el tallo o Spt4 / 5, es probable que se produzca una interacción física y sería coherente con el aumento de la eficiencia de terminación observado. Es tentador especular que aCPSF1 y el ribosoma interactúan con Spt4 / 5 unido a RNAP de una manera mutuamente excluyente similar a Rho y el ribosoma con NusG unido a RNAP en bacterias. Como consecuencia, la terminación de la transcripción y el acoplamiento de ribosomas pueden ser mutuamente excluyentes. Ribosomas acoplados a RNAP vía Spt4 / 5 evitaría las interacciones de aCPSF1 con el ARN naciente y evitaría la terminación prematura (Figura 2H). Alternativamente, una vez que aCPSF1 obtiene acceso a Spt4 / 5, puede interferir con TTC (Figura 2H). Esto sería una reminiscencia del reclutamiento de Rho por NusG-KOW a RNAP que conduce a la terminación de la transcripción de transcripciones de ARN no codificantes / no traducidas (Washburn et al., 2020). El hecho de que prevalezca el TTC o la terminación podría ser específico del gen o del operón, podría ser un objetivo para la regulación y puede variar de una especie a otra. Se han demostrado interacciones directas independientes del ARNm entre el RNAP bacteriano y el ribosoma. Es posible que en algunos casos, p. Ej., Durante la transcripción de ARNm cortos, el ribosoma arqueal pueda unirse al ARNm cerca del canal de salida del RNAP y hacer contactos directos entre el RNAP alargado y el ribosoma (Wang et al., 2020 Webster et al. , 2020).


¿Cómo funciona el acoplamiento traslacional en procariotas? - biología


El dogma central en procariotas versus células eucariotas

En procariotas (organismos sin membrana nuclear), ADN sufre replicación y transcripción y ARN se somete a traducción en un compartimento no dividido. Los tres procesos pueden ocurrir simultáneamente.

En eucariotas (organismos con un membrana nuclear), ADN sufre replicación y transcripción en el núcleo, y proteinas están hechos en el citoplasma. ARN por lo tanto debe viajar a través del membrana nuclear antes de que se someta a traducción. Esto significa que transcripción y traducción están físicamente separados. La transcripción primaria, ARN nuclear heterogéneo (hnRNA ), sufre una extensa procesamiento postranscripcional hacer un ARN mensajeroARNm) molécula que puede atravesar la membrana nuclear.


¿Cómo funciona el acoplamiento traslacional en procariotas? - biología

IntroducciónEstructura genética

Los genes contienen la información necesaria para que las células vivas sobrevivan y se reproduzcan. En la mayoría de los organismos, los genes están hechos de ADN, donde la secuencia de ADN particular determina la función del gen. Un gen se transcribe (copia) del ADN al ARN, que puede ser no codificante (ncRNA) con una función directa, o un mensajero intermedio (mRNA) que luego se traduce en proteína.

Cada uno de estos pasos está controlado por elementos de secuencia específicos, o regiones, dentro del gen. Cada gen, por lo tanto, requiere múltiples elementos de secuencia para ser funcionales. [2] Esto incluye la secuencia que realmente codifica la proteína funcional o ncRNA, así como múltiples regiones de secuencia reguladora. Estas regiones pueden ser tan cortas como unos pocos pares de bases, hasta muchos miles de pares de bases de largo.
Gran parte de la estructura genética es muy similar entre eucariotas y procariotas.

Estructura del gen procariota

Estos elementos comunes resultan en gran parte de la ascendencia compartida de la vida celular en organismos hace más de 2 mil millones de años. Las diferencias clave en la estructura genética entre eucariotas y procariotas reflejan su maquinaria divergente de transcripción y traducción. Comprender la estructura de los genes es la base para comprender la anotación, expresión y función de los genes.

El acceso a los diagramas disponibles gratuitamente es importante para los científicos, las profesiones médicas y los público en general. [7] [8] Sin embargo, las cifras actuales de estructura genética de acceso abierto tienen un alcance limitado (Figuras complementarias 1-4), mostrando típicamente uno o algunos aspectos (por ejemplo, empalme de exón o regiones promotoras). Los diagramas ricos en información que utilizan una combinación de colores y un diseño coherentes deberían ayudar a comprender conceptos complejos.

Este trabajo proporciona dos diagramas que resumen la compleja estructura y terminología de los genes. Los elementos comunes de la estructura genética se presentan en un diseño y formato coherentes para resaltar las relaciones entre los componentes. Diferencias clave entre eucariotas y procariotas se indican.
Resultados

Características comunes de la estructura genética

Las estructuras de ambos eucariotas y los genes procarióticos implican varios elementos de secuencia anidados. Cada elemento tiene una función específica en el proceso de múltiples pasos de expresión génica. Las secuencias y longitudes de estos elementos varían, pero las mismas funciones generales están presentes en la mayoría de los genes. [2] A pesar de que El ADN es una molécula de doble hebra, típicamente, solo una de las cadenas codifica información que la ARN polimerasa lee para producir ARNm que codifica proteínas o noARN codificante. Esta cadena & # 8216sense & # 8217 o & # 8216coding & # 8217, se ejecuta en la dirección 5 & # 8242 a 3 & # 8242 donde los números se refieren a los átomos de carbono de la columna vertebral & # 8217s azúcar ribosa. El marco de lectura abierto (ORF) de un gen, por lo tanto, generalmente se representa como una flecha que indica la dirección en la que se lee la cadena de sentido

La estructura de los genes eucariotas incluye características que no se encuentran en los procariotas. (Figura 1). La mayoría de estos se relacionan con la modificación postranscripcional de pre-ARNm para producir ARNm maduro listo para su traducción en proteína. Los genes eucariotas suelen tener más elementos reguladores para controlar la expresión génica en comparación con los procariotas. Esto es particularmente cierto en eucariotas multicelulares, humanos por ejemplo, donde la expresión génica varía ampliamente entre diferentes tejidos.

Que es centrifugar

Una característica clave de la estructura de los genes eucariotas es que sus transcripciones se subdividen típicamente en regiones de exón e intrón. Las regiones de exón se retienen en la molécula de ARNm madura final, mientras que las regiones de intrón se cortan (escinden) durante el procesamiento postranscripcional. [25] De hecho, las regiones intrónicas de un gen pueden ser considerablemente más largas que las regiones exónicas. Una vez empalmados, los exones forman una única región codificadora de proteínas continua y los límites de empalme no son detectables. El procesamiento postranscripcional eucariota también agrega una tapa 5 & # 8242 al comienzo del ARNm y una cola de poli-adenosina al final del ARNm. Estas adiciones estabilizan el ARNm y dirigen su transporte desde el núcleo al citoplasma, aunque ninguna de estas características está codificada directamente en la estructura de un gen.

Proceso de filtración

Procariotas

La organización general de los genes procariotas es marcadamente diferente de la de los eucariotas (Figura 2). La diferencia más obvia es que los ORF procariotas a menudo se agrupan en un operón policistrónico bajo el control de un conjunto compartido de secuencias reguladoras. Todos estos ORF se transcriben en el mismo ARNm y, por lo tanto, están co-regulados ya menudo cumplen funciones relacionadas. [26] [27] Cada ORF normalmente tiene su propio sitio de unión al ribosoma (RBS) de modo que los ribosomas traducen simultáneamente los ORF en el mismo ARNm. Algunos operones también muestran acoplamiento traslacional, donde las tasas de traducción de múltiples ORF dentro de un operón están vinculadas. [28] Esto puede ocurrir cuando el ribosoma permanece adherido al final de un ORF y simplemente se traslada al siguiente sin necesidad de un nuevo RBS. [29] El acoplamiento traslacional también se observa cuando la traducción de un ORF afecta la accesibilidad del siguiente RBS a través de cambios en el ARN secundario. estructura. [30] Tener varios ORF en un solo El ARNm solo es posible en procariotas porque su transcripción y traducción tienen lugar al mismo tiempo y en la misma ubicación subcelular. [


La secuencia del operador junto al promotor es el principal elemento regulador en procariotas. Las proteínas represoras unidas a la secuencia del operador obstruyen físicamente la enzima ARN polimerasa, lo que evita la transcripción. [32] [33] Los riboswitches son otra secuencia reguladora importante que se encuentra comúnmente en las UTR procariotas. Estas secuencias cambian entre alternativas secundarias estructuras en el ARN dependiendo de la concentración de clave metabolitos. Las estructuras secundarias bloquean o revelan regiones de secuencia importantes como las RBS. Los intrones son extremadamente raros en procariotas y, por lo tanto, no juegan un papel significativo en la regulación de genes procariotas. [


¿Cómo funciona el acoplamiento traslacional en procariotas? - biología

C2006 / F2402 '11 ESQUEMA DE LA CONFERENCIA # 9

(c) 2011 Dr. Alice Heicklen y Dr. Deborah Mowshowitz, Universidad de Columbia, Nueva York, NY. Última actualización 18/02/2011 09:34 AM.

Folletos: 9A Elementos regulatorios e imagen de un gen eucariota típico (en Word, no en pdf)
9B Transcription Complex & amp Modular Regulation: este folleto está publicado en Courseworks

I. ¿Cómo se activa un gen eucariota?

A. El problema: Es necesario desplegar / aflojar la cromatina antes de que sea posible la transcripción. No se puede simplemente agregar ARN polimerasa (y TF basales) al ADN y comenzar la transcripción. El ADN está en cromatina y debe hacerse accesible.

B. Entonces, ¿cómo puede ocurrir la transcripción?

1. Necesita varios pasos que no se encuentran en procariotas

una. Debe descomponerse (aflojarse) la eucromatina a un estado transcribible = relativamente suelto (comparado con heterocromatina y comparado con eucromatina inactiva). ¿Sacar fibra de 30 nm a la etapa de cuentas en una cuerda?

B. Muchos factores de transcripción (TF) deben unirse al ADN primero - antes de que la ARN polimerasa se una.

C. La polimerasa debe unirse a los TF (no directamente al ADN) para obtener la transcripción real.

2. ¿Qué cambia el estado de la cromatina? (Para apretar o aflojar.)

una. Remodelación de proteínas: estos son responsables de mover y / o aflojar los nucleosomas. Ver Sadava fig. 16,19 (14,17). Estos pueden ser un conjunto separado de proteínas o los TF que activan las enzimas modificadoras.

B. Enzimas que modifican las colas de histonas. Los cambios en la modificación pueden tener un efecto directo y / o afectar la unión de proteínas reguladoras. Algunos ejemplos:

(1). Fosforilación de H1 ocurre en M cambios en la actividad quinasa y fosfatasa afectan el estado de las histonas y el plegamiento de la cromatina en paralelo con los cambios en las láminas como se discutió la última vez.

(2). Acetilación de lys cadenas laterales de histonas. Acetilación de histonas & # 8594 cromatina más activa y suelta. La acetilación de H3 & amp H4 es más alta en cromatina activa.

(3). Metilación - Los efectos dependen de qué cadenas laterales de aminoácidos en qué posición de la proteína están metiladas; algunas modificaciones aumentan la probabilidad de transcripción y otras la disminuyen. (El ADN también se puede metilar, ver más abajo).

C. Metilación de ADN: en la mayoría de los organismos, tanto el ADN y las histonas pueden estar metiladas. (Los grupos metilo se pueden agregar a los C en el ADN, así como a las cadenas laterales de AA).

Por lo general, pero no siempre, la metilación del ADN es mayor en la cromatina más inactiva / condensada.

En algunos organismos, no hay metilación del ADN.

D. 'Código' general de modificación de histonas - es posible que cada combinación de modificaciones a las colas de histonas tenga un significado específico. Para obtener una explicación completa (para su información), consulte Alberts. (O vaya a PubMed en http://www.ncbi.nlm.nih.gov/sites/entrez, haga clic en libros en la esquina superior derecha e ingrese 'código de histona' en el cuadro de término de búsqueda).

3. ¿Qué desencadena el proceso de apriete o aflojamiento? ¿Los TF son lo primero o las enzimas de remodelación / modificación? Modelo actual

una. Los TF reguladores (activadores) se unen primero - que desencadena remodelaciones, modificaciones, etc. Afloja la cromatina en la zona a transcribir.

B. Basal TF se une más tarde - Después de que la cromatina se afloja, los TF basales (y posiblemente más TF reguladores) pueden unirse al ADN, la pol II puede unirse a los TF y se produce la transcripción.

4. ¿Cómo encaja esto con los resultados de sensibilidad a la DNasa?

una. Loosest - Regiones donde se unen los factores de transcripción - - eliminar los nucleosomas y / o aflojarlos mucho = sitios hipersensibles.

B. Más suelto - Regiones que se están transcribiendo - tienen nucleosomas de alguna manera & quot; aflojados & quot o & quot; remodelados & quot; pero no remoto.

C. Suelto - Regiones que no se transcriben: tienen nucleosomas regulares ('sueltos', en relación con la heterocromatina, pero 'apretados' o 'no tan sueltos' en comparación con la eucromatina transcrita). Las regiones que no se transcriben a menudo se encuentran en eucromatina, no en heterocromatina.


II. Detalles de la transcripción en eucariotas (como frente a procariotas) Véase Becker Ch 21, págs. 660-664 (665-670).

A. Más de todo lo necesario para la transcripción en eucariotas.

1. Múltiples ARN polimerasas (ver última lección). Nos centraremos en pol II (produce ARNm).

2. Más proteínas - Necesita TF, no solo pol de ARN.

3. Más secuencias reguladoras - muchas dif. unos se unen dif. TF

4. Una descripción general y algo de terminología

  • Elemento regulador que actúa sobre cis = afecta solo a la molécula de ácido nucleico en la que se encuentra. Por lo general, es una secuencia de ADN que se une a alguna proteína reguladora.

  • Elemento regulador que actúa en trans = afecta a las secuencias nucleicas diana en cualquier parte de la célula. La secuencia reguladora codifica una molécula reguladora, generalmente una proteína, que se une a un objetivo, generalmente una secuencia de ADN.

  • El término trans actuando puede usarse para referirse a la molécula reguladora (normalmente una proteína) o a la secuencia de ADN que la codifica.

  • Elementos que actúan cis = ADN en sí mismo = el mismo en todas las células del organismo multicelular = diana de las moléculas reguladoras que actúan en trans.

  • Moléculas reguladoras de acción trans = producto de ADN = TF y otras moléculas = diferentes en diferentes tipos de células y en diferentes momentos.

  • En euk. el número de diferentes tipos de elementos de control que actúan en cis y trans es mucho mayor que en los procariotas. ¿Cómo son? Vea abajo.

  • La regulación puede ser & quot + & quot o & quot- & quot, dependiendo de la función de la proteína.

  • Control negativo: si la proteína reguladora bloquea la transcripción.

  • Control positivo: si la proteína reguladora mejora la transcripción.

  • Euk contra Prok. - El control negativo (uso de represores) parece ser más común en prok. control positivo (uso de activadores) más común en euk.

  • Cómo distingue el control positivo del negativo, por los efectos de las eliminaciones.

B. Detalles de los sitios reguladores (que actúan en cis) en el ADN. Los procariotas tienen promotores y operadores. ¿Qué secuencias tienen los eucariotas en el ADN que afectan la transcripción? (La siguiente discusión se refiere principalmente a la regulación de la transcripción por RNA pol II. Ver textos especialmente Becker para detalles sobre promotores, etc. para pol I & amp III.) Ver Sadava Fig. 16.15 (14.14) o Becker fig.23-21 o folleto 9A para la estructura de los sitios reguladores de un gen codificador de proteínas típico. Tres tipos de sitios regulatorios:

1. Promotor principal

una. Numeración. La posición de las bases generalmente se cuenta a lo largo de la cadena de sentido desde el inicio de la transcripción.

(1). & quotIniciar & quot = Punto donde realmente comienza la transcripción (generalmente marcado con una flecha doblada) = cero.

(2). Río arriba y río abajo

(a). Aguas abajo = Yendo hacia el extremo de 3 ' en la hebra de los sentidos = en la dirección de la transcripción)

(B). Aguas arriba = Yendo hacia el extremo 5 'en la hebra de sentido = en dirección opuesta a la transcripción.

(3). Numeración: algunos ejemplos

(a). +10 = 10 bases corriente abajo desde el inicio = 10 bases después del inicio de la transcripción.

(B). -25 = 25 bases corriente arriba desde el inicio = 25 bases antes de alcanzar el inicio de la transcripción.

(C). +1 = primera base en la transcripción una que tiene un límite (base modificada unida al extremo de 5 ').

(4). Numeración - miscelánea características

(a). No hay una base 'cero', al igual que no hay un año 'cero' entre BC y AD y no hay una hora cero entre am y pm.

(B). En algunos casos, la posición de las bases se cuenta a lo largo de la cadena sensorial desde el comienzo de traducción.Si se hace de esta manera, la A en el primer AUG es +1. Sin embargo, se asume que la numeración es desde el inicio de transcripcióna menos que se especifique lo contrario.

(C). Los TF, ARN pol, etc. se unen a surcos en el ADN de doble hebra, no a una hebra. Sin embargo, las posiciones en el ADN generalmente se especifican en términos de la cadena con sentido únicamente.Esto NO significa que la proteína se una solo a la cadena con sentido.

B. Promotor principal en sí El promotor central se define por lo que necesita para permitir que la ARN polimerasa comience en el lugar correcto. ¿Qué incluye?

(1). Punto real de inicio de la transcripción (donde está la flecha doblada) más algunas bases a cada lado de 'inicio'. Por lo general, incluye algunas bases de la 5 'UTR (región no traducida).

(2). Sitios de encuadernación: Parte donde comienza la unión de la polimerasa de ARN y los TF basales, generalmente la sección justo aguas arriba (antes) del punto de inicio. A menudo incluye una secuencia corta llamada caja TATA (generalmente alrededor de 25 bases antes del punto de inicio).

(3). Características adicionales: A menudo incluye algunas secuencias adicionales o diferentes además de las especificadas. No todos los promotores de Pol II son iguales. (Si está interesado en los detalles, consulte Becker 21-12b (13 b) o 23-21)

2. Elementos de control proximal. (Proximal = Cerca).

una. Localización: Promotor cercano al núcleo y comienzo de la transcripción usualmente “aguas arriba” (en el lado 5 'del comienzo de la transcripción). Usualmente incluye elementos reguladores hasta -100 o -200 (bases).

B. Terminología: A veces se considera parte del promotor principal.

C. Función: La unión de proteínas apropiadas promueve o inhibe la transcripción. Identificado por efectos de eliminaciones. La secuencia y el mecanismo de acción varían.

3. Elementos de control distal (distal = lejano)

una. Dos tipos: potenciadores y silenciadores de amplificador. Estos elementos de control pueden disminuir (silenciadores) o aumentar la transcripción (potenciadores).

B. Estos pueden estar bastante lejos del gen que controlan. (en 5 ' o 3 'dirección = aguas arriba o aguas abajo). Puede estar en intrones o en regiones no transcritas.

C. Estos pueden funcionar en ambas orientaciones: Invertirlos no tiene ningún efecto, diferente a con promotores. Véase la fig. De Becker. 23-22 (o folleto 9B).

D. Mecanismo de acción - enlazar TF's ver más abajo.

4. Terminología y amplificador misceláneo. Detalles - Esto es para referencia, puede que no se discuta en clase.

una. Cajas = secuencias cortas que se encuentran en regiones reguladoras (p. ej., cuadro TATA)

B. Secuencias de consenso = secuencia que contiene la base más común encontrada en cada posición para todas las secuencias de ese tipo. Es probable que cualquier versión individual de la secuencia sea diferente del consenso en una o más posiciones. (Ej: TATAAAA = secuencia de consenso para la caja TATA. Significa que T es la base más común en la primera posición, A es más común en la segunda posición, etc.)

C. Para organismos multicelulares, el término & quotoperator & quot no se usa para el sitio / secuencia de ADN donde se encuentra una proteína reguladora. ¿Por qué? Porque no hay ARNm policistrónico y no hay operones en eucariotas superiores. (Son algunos en euk unicelular).

C. ¿Cómo funcionan los factores de transcripción basales?

1. Lo mismo en todas las celdas. Necesario para iniciar la transcripción en todas las células. Ver Sadava fig. 16,14 (14,13) (14,12) o Becker fig. 21-13 (21-14).

2. Propiedades

una. Se necesitan muchos TF basales.

B. TF basales para ARN pol. II .

(1). Terminología: Los TF basales para pol II se denominan TFIIA, TFIIB, etc.

(2). El principal es TFIID, que en sí mismo tiene muchas subunidades. La subunidad más estudiada es TBP (TATA Binding pagrotein - Ver Becker fig. 21-14 (21-15).) Reconoce la caja TATA cuando hay una.

(3). Otras polimerasas también tienen TF, pero los TF para pol II son de gran interés, ya que el mRNA pol II y # 8594

C. Los TF basales se unen primero al promotor central y luego el ARN pol se une a ellos. Se necesitan muchas proteínas para comenzar. La ARN polimerasa no no se unen directamente al ADN.

D. ¿Cómo funcionan los FT reguladores o específicos de tejidos?

1. Se utilizan diferentes en diferentes tipos de células o en determinados momentos. No todos son necesarios en todas las células. Véase la fig. De Becker. 23-24.

2. Propiedades

una. Vincularse a áreas fuera del promotor principal - generalmente a potenciadores o silenciadores (elementos de control distales) pero a veces a elementos de control proximales

B. Cuando los TF reguladores se unen, pueden disminuir o promover la transcripción.

(1). Activadores. Los TF se denominan activadores si se unen a potenciadores y / o aumentan la transcripción.

(2). Represores.Los TF se denominan represores si se unen a silenciadores y / o disminuyen la transcripción.

C. Cómo los TF reguladores afectan la transcripción: Se cree que el ADN gira alrededor de modo que el silenciador / potenciador está cerca del promotor central. Los TF en el potenciador ayudan a estabilizar (o bloquear) la unión de los TF basales directa o indirectamente al promotor central. (Vea Becker fig. 23-23 o Sadava fig. 16.15 (14.14) y la sección sobre TF regulatorios a continuación).

D. Euk. vs Prok. represores - ambos 'represores' interfieren con la transcripción, pero el mecanismo de acción es diferente.

mi. Papel de los coactivadores - Las proteínas que se unen a los TF en el potenciador e influyen en la transcripción (pero no se unen directamente al ADN) a menudo se denominan proteínas coactivadoras (o correpresoras). Hay 2 formas en que los coactivadores afectan la transcripción:

(1). Actuar como mediador: conecta dos partes de la máquina de transcripción. Una parte del mediador se une a TF (que está unido al potenciador o silenciador) y otra parte del mediador se une a factores de transcripción basales (o pol II) en el promotor central y / o elementos de control proximales. Mediador = nombre habitual del complejo de coactivadores que actúan de esta forma.

(2). Modifica el estado de la cromatina. Se une a TF en el potenciador y afloja la cromatina en el gen que se transcribirá. Las proteínas remodeladoras y las enzimas modificadoras de histonas se incluyen en esta categoría.

Para revisar la estructura de los genes y los TF de los amplificadores, pruebe los problemas 4R-2, 4R-5A y 4R6-A.

F. Coordinar el control. Un grupo de genes puede activarse o desactivarse a la vez en respuesta a la misma señal (choque térmico, hormonas, etc.).

(1). Procariotas contra eucariotas: Ambos prok. y euk. exhiben control coordinado, pero el mecanismo es diferente. (Vea la tabla de abajo.)

(2). Ubicación de genes controlados coordinadamente

(a). En los procariotas, los genes controlados de forma coordinada se encuentran juntos en los operones.

(B). En eucariotas, los genes controlados coordinadamente no necesitan estar cerca unos de otros, solo tienen que tener los mismos elementos de control (que actúan en cis). Ver Sadava fig. 16,17 (14,16).

(3). Elementos de control:

(a). Todos los genes activados en el mismo tipo de célula y / o en las mismas condiciones comparten los mismos elementos de control; por lo tanto, todos estos genes responden a los mismos TF reguladores. El resultado son múltiples ARNm, todos hechos en respuesta a las mismas señales.

(B). La mayoría de los genes tienen múltiples elementos de control (que actúan en cis). Por lo tanto, la transcripción de la mayoría de los genes se ve afectada por más de un TF.

(C). La transcripción de cualquier gen en particular depende de las combinaciones de TF, no solo uno, disponibles en ese tipo de célula.

(4). Diferencias en TF's. Los diferentes tipos de células producen diferentes TF reguladores. Por lo tanto, se activan / desactivan diferentes grupos de genes controlados coordinadamente. Véase la fig. De Becker. 23-24.

(5). Comparación de la situación en procariotas vs eucariotas multicelulares:


RESULTADOS

Un modelo mecanicista de acoplamiento traslacional en operones bacterianos

Considere un operón bacteriano multicistrónico que contiene un promotor, una región no traducida 5 '(UTR) y al menos dos secuencias codificantes de proteínas (CDS), separadas por regiones intergénicas, seguidas de un terminador transcripcional (Figura 1A). El modelo biofísico completo calcula las tasas de traducción para todos los CDS dentro de un operón, de acuerdo con las secuencias de la UTR 5 ', los CDS y las regiones intergénicas. Las interacciones del ribosoma con un ARNm de secuencia arbitraria se cuantifican de acuerdo con un modelo de energía libre de múltiples términos desarrollado previamente (39-41). Aquí, asumimos que cada CDS ha sido suficientemente optimizado en codones para que sus tasas de elongación de traducción sean altas y, por lo tanto, sus tasas de iniciación de traducción son el paso limitante en el proceso de traducción general. El modelo tiene cinco coeficientes desconocidos que determinamos midiendo los niveles de expresión de variantes de operón diseñadas racionalmente. El modelo tampoco tiene en cuenta los cambios en la tasa de transcripción o los elementos de la secuencia que podrían afectar la estabilidad del ARNm y, por lo tanto, existe una constante de proporcionalidad que relaciona las tasas de iniciación de la traducción con los niveles de expresión de proteínas.

Un modelo mecanicista de acoplamiento traslacional. (A) Traducción de un operón bi-cistrónico. El esquema muestra el promotor (flecha negra), el (cuadro amarillo) 5 ′ UTR, la secuencia de codificación (rojo) aguas arriba, la región intergénica (cuadro naranja), la secuencia de codificación (verde) aguas abajo y el terminador transcripcional (hexágono) . La región intergénica contiene una estructura de ARN inhibidora, una secuencia de Shine-Dalgarno (SD) y secuencias de codificación superpuestas. (B) El reinicio del ribosoma se produce cuando un ribosoma que se alarga corriente arriba se disocia y se vuelve a ensamblar en una región intergénica, seguido del inicio de la traducción de la secuencia codificante corriente abajo. (C) La iniciación del ribosoma de novo ocurre cuando los ribosomas citosólicos se ensamblan en el ARNm en regiones intergénicas e inician la traducción de la secuencia codificante aguas abajo. (D) El modelo biofísico propuesto de acoplamiento traslacional cuantifica las interacciones moleculares que controlan tanto la reiniciación del ribosoma como las tasas de iniciación de novo de acuerdo con una secuencia de ARNm ingresada. Los componentes del modelo y su región de secuencia correspondiente están codificados por colores, incluidas las energías libres de las estructuras de ARN inhibidoras (acopladas y no acopladas), la distancia intergénica, la energía libre del estado unido al ribosoma y la velocidad de traducción de la secuencia codificante aguas arriba.

Un modelo mecanicista de acoplamiento traslacional. (A) Traducción de un operón bi-cistrónico. El esquema muestra el promotor (flecha negra), el (cuadro amarillo) 5 ′ UTR, la secuencia de codificación (rojo) aguas arriba, la región intergénica (cuadro naranja), la secuencia de codificación (verde) aguas abajo y el terminador transcripcional (hexágono) . La región intergénica contiene una estructura de ARN inhibidora, una secuencia de Shine-Dalgarno (SD) y secuencias de codificación superpuestas. (B) El reinicio del ribosoma se produce cuando un ribosoma que se alarga corriente arriba se disocia y se vuelve a ensamblar en una región intergénica, seguido del inicio de la traducción de la secuencia codificante corriente abajo. (C) La iniciación del ribosoma de novo ocurre cuando los ribosomas citosólicos se ensamblan en el ARNm en regiones intergénicas e inician la traducción de la secuencia codificante aguas abajo. (D) El modelo biofísico propuesto de acoplamiento traslacional cuantifica las interacciones moleculares que controlan tanto la reiniciación del ribosoma como las tasas de iniciación de novo de acuerdo con una secuencia de ARNm ingresada. Los componentes del modelo y su región de secuencia correspondiente están codificados por colores, incluidas las energías libres de las estructuras de ARN inhibidoras (acopladas y no acopladas), la distancia intergénica, la energía libre del estado unido al ribosoma y la velocidad de traducción de la secuencia codificante aguas arriba.

Para los operones con tres o más CDS, las tasas de iniciación de la traducción se calculan de manera iterativa y anidada. Usando la Ecuación (3), se calcula la tasa de reinicio del ribosoma para el tercer CDS, que depende de la tasa de traducción calculada para el segundo CDS. Usando las ecuaciones (4) y (5), se calcula la tasa de iniciación de novo del ribosoma del tercer CDS, que depende de la secuencia intergénica entre el segundo y tercer CDS, así como la tasa de traducción calculada del segundo CDS. En conjunto, la Ecuación (2) determina la tasa de iniciación de la traducción del tercer CDS. Las iteraciones continúan para los CDS restantes en el operón.

Medidas cuantitativas de la tasa de reinicio del ribosoma

Primero medimos cuantitativamente el grado de reinicio del ribosoma y su dependencia de la secuencia intergénica y la distancia, mediante el diseño racional de regiones intergénicas sintéticas, controlando las tasas de traducción aguas arriba y midiendo la traducción aguas abajo en un sistema informador bi-cistrónico mRFP1 y GFPmut3b ( Figura 2A). Se construyeron e insertaron once regiones intergénicas en el operón bi-cistrónico con distancias intergénicas que variaban de D12 = −25 (5′-AGOCCGCAGUAUACCGGUCAAGUAA-3 ′) a D12 = 25 (5′- UAACAUACGUAUCCCACAUCCCACACAUAGO-3 ′). Estas regiones intergénicas se diseñaron para minimizar la otra fuente de acoplamiento traslacional, la tasa de iniciación de novo del ribosoma, evitando la formación de estructuras de ARNm y asegurando que la subunidad ribosómica 30S se uniera mal al sitio de unión del ribosoma del CDS corriente abajo, cuantificado por un alto ΔGRAMOtotal energía libre (menor afinidad por los ribosomas). Luego diseñamos dos secuencias de sitios de unión de ribosomas sintéticos que controlan la expresión de mRFP1 con tasas de traducción de 10 y 94 000 au en la escala proporcional de la calculadora RBS.

Medición y modelado de tasas de reinicio de ribosomas. (A) La distancia intergénica se calcula de acuerdo con las posiciones de los codones de parada y de inicio en las secuencias de codificación aguas arriba y aguas abajo, respectivamente, dentro de operones bi-cistrónicos diseñados racionalmente. (B) Las mediciones de fluorescencia muestran los niveles de expresión de los reporteros (inferior) mRFP1 y (superior) GFPmut3b después de que se modificaron las tasas de traducción de mRFP1 para que fueran (barras negras) muy bajas o (beige) muy altas. (C) El análisis de estas medidas revela cómo el coeficiente de reinicio (kreiniciación) depende de la distancia intergénica según un modelo de tres parámetros (R 2 = 0.91, PAG = 5,94 × 10 -12). Los valores y las barras de error son la media y la DE de al menos dos réplicas.

Medición y modelado de tasas de reinicio de ribosomas. (A) La distancia intergénica se calcula de acuerdo con las posiciones de los codones de parada y de inicio en las secuencias codificantes aguas arriba y aguas abajo, respectivamente, dentro de operones bi-cistrónicos diseñados racionalmente. (B) Las mediciones de fluorescencia muestran los niveles de expresión de los reporteros (inferior) mRFP1 y (superior) GFPmut3b después de que se modificaron las tasas de traducción de mRFP1 para que fueran (barras negras) muy bajas o (beige) muy altas. (C) El análisis de estas medidas revela cómo el coeficiente de reinicio (kreinicio) depende de la distancia intergénica según un modelo de tres parámetros (R 2 = 0.91, PAG = 5,94 × 10 -12). Los valores y las barras de error son la media y la DE de al menos dos repeticiones.

Las once secuencias intergénicas y dos secuencias RBS cadena arriba se combinaron para construir 22 operones bi-cistrónicos. Los niveles de fluorescencia de mRFP1 y GFPmut3b se controlaron durante un E. coli Cultivos de DH10B mantenidos en la fase de crecimiento exponencial y registrados mediante citometría de flujo (sección "Materiales y métodos"). Todas las distribuciones de fluorescencia de una sola célula fueron unimodales. Todas las secuencias y medidas se enumeran en Datos suplementarios. Como era de esperar, la expresión del CDS cadena arriba (mRFP1) aumentó sustancialmente como resultado del aumento de su tasa de traducción, en promedio 3160 veces. Al mismo tiempo, la expresión del CDS aguas abajo (GFPmut3b) también aumentó sustancialmente, de entre 4 y 49 veces, y la magnitud del aumento dependió de la distancia intergénica (Figura 2B).

Un modelo intergénico dependiente de la distancia de la tasa de reinicio del ribosoma

Cuantificamos la relación entre la tasa de reinicio del ribosoma y la distancia intergénica comparando el aumento en la expresión de CDS aguas arriba con el aumento en la expresión de CDS aguas abajo. Para cada distancia intergénica, calculamos el valor aparente de kreinicio dividiendo la diferencia en la expresión de CDS descendente (GFPelevado - GFPbajo fluorescencia) por la diferencia en la expresión de CDS aguas arriba (mRFP1elevado - mRFP1bajo fluorescencia), que produce un coeficiente radiométrico que es independiente de los cálculos de nuestro modelo (Figura 2C). Encontramos eso kreiniciación tiene una relación lineal con la distancia intergénica entre −25 y 25, excepto para una distancia de −4. El modelo resultante tiene tres parámetros ajustados y calcula con precisión las tasas de traducción de CDS descendentes para los 22 operones bi-cistrónicos (R 2 = 0.91, PAG = 5,94 × 10 −12) (Figura complementaria S1). La reiniciación del ribosoma fue en gran parte constante durante D entre 0 y 25 nucleótidos con kreiniciación = 0.0072 ± 0.0018, y disminuyó a medida que la distancia intergénica se volvió más negativa que D = −10 con una pendiente constante de 0,0004 por nucleótido (0,00040 ± 3 × 10 −5). Sin embargo, a una distancia intergénica de -4, la tasa de reinicio fue sustancialmente mayor con kreiniciación = 0,0220, debido a la unión mejorada de ARNt-ARNm. En la sección de Discusión, proponemos un modelo mecanicista que explica cómo las tasas de reinicio del ribosoma dependen de las distancias intergénicas en términos de las tasas de escaneo y desprendimiento del ribosoma.

Las medidas de fluorescencia y, por tanto, los valores absolutos de kreinicio dependía de una única constante de proporcionalidad desconocida K que refleja las proteínas informadoras seleccionadas y los parámetros de citometría de flujo utilizados para medir sus niveles de fluorescencia. Para determinar el valor de esta constante de proporcionalidad, registramos las fluorescencias de mRFP1 y GFPmut3b en operones mono-cistrónicos en el mismo vector y encontramos una cantidad 10,3 veces menor de fluorescencia de GFPmut3b, en comparación con la fluorescencia de mRFP1, al ajustar las diferentes tasas de expresión de proteínas. Este aparente K está directamente relacionado con la constante kPAG que se multiplica por kreiniciación para llegar a la tasa de reinicio del ribosoma K multiplicado por kPAG debe ser igual a uno. Como resultado, establecemos kPAG a 10 y trátelo como una constante durante el resto de este estudio. A continuación, utilizamos todas las medidas de operón y un análisis de sensibilidad para encontrar el valor de kPAG, lo que resultó en una respuesta similar.

Predicción de tasas de acoplamiento traslacional en operones bi-cistrónicos

A continuación, investigamos la capacidad del modelo biofísico para predecir la tasa de acoplamiento traslacional diseñando y caracterizando 76 variantes de operón bi-cistrónico con seis regiones intergénicas diferentes. Las regiones intergénicas se diseñaron para tener estructuras de ARNm inhibidoras que se superponen con el CDS cadena arriba y se despliegan por los ribosomas que se alargan cadena arriba. Tres de las regiones tienen la misma distancia intergénica (D = −4) con estructuras de ARNm acopladas traslacionalmente que tienen energías libres de despliegue cada vez más altas (ΔGRAMOacoplamiento = −5,3, −12,6 y −16,9 kcal / mol) (Figura 3A).En particular, las dos últimas estructuras de ARNm tienen formas idénticas, pero con diferentes composiciones de nucleótidos y estabilidades dúplex. Las otras tres regiones tienen diferentes distancias intergénicas (D = +3, −1, −11) con estructuras de ARNm inhibidoras superpuestas y estables de manera similar (ΔGRAMOacoplamiento = −8,9 o −11,1 kcal / mol) (Figura 3B). Para todas las regiones intergénicas, diseñamos 12-13 secuencias de RBS sintéticas para aumentar sistemáticamente la tasa de traducción de los CDS ascendentes de 1 a 391 000 en la escala proporcional de la calculadora de RBS. Las tasas de traducción de los CDS descendentes también dependen de las tasas de traducción basales (no acopladas), determinadas el ΔGRAMOfinal y ΔGRAMOsin acoplamiento energías libres. Todas las secuencias, medidas y cálculos se enumeran en Datos suplementarios.

Predicción del acoplamiento traslacional en operones bi-cistrónicos. Las regiones intergénicas de los operones indicadores bi-cistrónicos se diseñaron y caracterizaron para determinar cuantitativamente cómo las estructuras inhibidoras de ARN controlan el acoplamiento traduccional. (líneas negras) Predicciones de modelos biofísicos utilizando C = 0,81 y kPAG = 10 se muestran junto (círculos negros) en las mediciones de nivel de expresión de mRFP1 aguas arriba y GFPmut3b aguas abajo como mRFP1 las tasas de traducción aumentan sistemáticamente. Los colores de los nucleótidos son los mismos que en la Figura 1. (A) Calculado ΔGRAMOacoplamientoGRAMOsin acoplamiento) las energías libres son −5,3 (−20,1), −12,6 (−16,3) y −16,9 (−16,3) kcal / mol, respectivamente. Los recuadros resaltan una mutación de cuatro nucleótidos entre dos variantes de operón. (B) Se diseñaron tres operones bicistrónicos adicionales con diferentes distancias intergénicas (D = +3, −1 y −11, respectivamente) y estructuras de ARN inhibitorias. Δ calculadoGRAMOacoplamientoGRAMOsin acoplamiento) las energías libres son −8,9 (−12,6), −8,9 (−9,8) y −11,1 (−17,7) kcal / mol, respectivamente. (C) Las tasas de iniciación de la traducción previstas se comparan con los niveles de expresión medidos de CDS aguas abajo (GFPmut3b). Los factores de proporcionalidad aparente son (cuadrados azules, pTTBd-4-13) 9,8, (círculos rojos, pTTBd-4-17) 5,5, (diamantes verdes, pTTBd-4-5) 17,3, (círculos negros, pTTBd3-9) 31,0 , (triángulos rosas, pTTBd-1-9) 30,8 y (estrellas marrones, pTTBd-11-11) 4,3 con coeficientes de Pearson R 2 de 0,85 (PAG = 5 × 10 −5 ), 0.86 (PAG = 8 × 10 −6 ), 0.84 (PAG = 3 × 10 −5 ), 0.77 (PAG = 2 × 10 −4 ), 0.74 (PAG = 4 × 10 −4) y 0,60 (PAG = 0,0069), respectivamente. Los valores y las barras de error son la media y la DE de tres réplicas. (D) Los niveles de ARNm del mRFP1 y gfpmut3b Las secuencias codificantes dentro de cuatro variantes del operón bicistrónico pTTBd-4-17 se midieron como mRFP1 Las tasas de traducción aumentaron de 1 a 200 000 au en la escala proporcional de la calculadora RBS, que muestra los efectos de la traducción aguas arriba sobre la estabilidad del ARNm en un operón. Los valores y las barras de error son la media y la DE de al menos dos repeticiones.

Predicción del acoplamiento traslacional en operones bi-cistrónicos. Las regiones intergénicas de los operones indicadores bi-cistrónicos se diseñaron y caracterizaron para determinar cuantitativamente cómo las estructuras inhibidoras de ARN controlan el acoplamiento traduccional. (líneas negras) Predicciones de modelos biofísicos utilizando C = 0,81 y kPAG = 10 se muestran junto (círculos negros) en las mediciones de nivel de expresión de mRFP1 aguas arriba y GFPmut3b aguas abajo como mRFP1 las tasas de traducción aumentan sistemáticamente. Los colores de los nucleótidos son los mismos que en la Figura 1. (A) Calculado ΔGRAMOacoplamientoGRAMOsin acoplamiento) las energías libres son −5,3 (−20,1), −12,6 (−16,3) y −16,9 (−16,3) kcal / mol, respectivamente. Los recuadros destacan una mutación de cuatro nucleótidos entre dos variantes de operón. (B) Se diseñaron tres operones bicistrónicos adicionales con diferentes distancias intergénicas (D = +3, −1 y −11, respectivamente) y estructuras de ARN inhibitorias. Δ calculadoGRAMOacoplamientoGRAMOsin acoplamiento) las energías libres son −8,9 (−12,6), −8,9 (−9,8) y −11,1 (−17,7) kcal / mol, respectivamente. (C) Las tasas de iniciación de la traducción previstas se comparan con los niveles de expresión medidos de CDS aguas abajo (GFPmut3b). Los factores de proporcionalidad aparente son (cuadrados azules, pTTBd-4-13) 9,8, (círculos rojos, pTTBd-4-17) 5,5, (diamantes verdes, pTTBd-4-5) 17,3, (círculos negros, pTTBd3-9) 31,0 , (triángulos rosas, pTTBd-1-9) 30,8 y (estrellas marrones, pTTBd-11-11) 4,3 con coeficientes de Pearson R 2 de 0.85 (PAG = 5 × 10 −5 ), 0.86 (PAG = 8 × 10 −6 ), 0.84 (PAG = 3 × 10 −5 ), 0.77 (PAG = 2 × 10 −4 ), 0.74 (PAG = 4 × 10 −4) y 0,60 (PAG = 0,0069), respectivamente. Los valores y las barras de error son la media y la DE de tres réplicas. (D) Los niveles de ARNm del mRFP1 y gfpmut3b Las secuencias codificantes dentro de cuatro variantes del operón bicistrónico pTTBd-4-17 se midieron como mRFP1 Las tasas de traducción aumentaron de 1 a 200 000 au en la escala proporcional de la calculadora RBS, que muestra los efectos de la traducción aguas arriba sobre la estabilidad del ARNm en un operón. Los valores y las barras de error son la media y la DE de al menos dos repeticiones.

Monitoreamos los niveles de expresión de CDS aguas arriba (fluorescencia mRFP1) y aguas abajo (fluorescencia GFPmut3b) de los 76 operones bi-cistrónicos durante cultivos prolongados mantenidos en la fase de crecimiento exponencial, y registramos distribuciones de fluorescencia unicelulares mediante citometría de flujo (Métodos). Los RBS ascendentes que controlan la traducción de CDS ascendentes hicieron que la fluorescencia de mRFP1 aumentara de 21 000 a 44 000 veces con tasas de inicio de traducción bien predichas (R 2 = 0,57) (Figura complementaria S2), promediado sobre las seis regiones intergénicas. Las excepciones son las secuencias de 391000 au RBS, que produjeron fluorescencias de mRFP1 similares a las de las 94000 au RBS, potencialmente debido a la introducción de otro paso limitante de la velocidad en la expresión génica, como el alargamiento de la traducción. Desde los niveles de expresión de CDS aguas arriba más bajos a más altos, la expresión de CDS aguas abajo aumentó en 57, 126 y 95 veces, respectivamente, para las tres primeras regiones intergénicas (Figura 3A) y 54, 125 y 55 veces, respectivamente. , para las segundas tres regiones intergénicas (Figura 3B). De acuerdo con el modelo biofísico propuesto, hubo una relación sigmoidea entre los niveles de expresión de CDS aguas arriba y aguas abajo.

Se esperaba que los cambios en el nivel de ARNm pudieran desempeñar un papel en los cambios observados en la expresión de CDS aguas abajo a medida que las secuencias codificantes mal traducidas se vuelven accesibles a la actividad de unión y escisión de ARNasa. Particularmente a bajas tasas de traducción de CDS aguas arriba, la desestabilización de todo el ARNm afectará a la expresión de CDS aguas arriba y aguas abajo. Para investigar esta posibilidad, medimos los niveles de ARNm de un operón bi-cistrónico a medida que la traducción de CDS aguas arriba aumentaba de una tasa muy baja a una muy alta. Seleccionamos una variante de operón (pTTBd-4-17, Figura 3A, derecha) y empleamos qRT-PCR para medir mRFP1 y gfpmut3b Niveles de ARNm en comparación con los niveles de ARNr 16S endógeno (sección "Materiales y métodos"). Encontramos que los niveles de ARNm para el CDS aguas arriba se redujeron aproximadamente 2 veces a medida que su tasa de traducción se redujo sustancialmente (Figura 3D). Debido a los efectos del procesamiento de ARNm, el nivel de ARNm de CDS corriente abajo también disminuyó aproximadamente 1,7 veces cuando la tasa de traducción de CDS corriente arriba era baja. Por lo tanto, aunque los cambios en la estabilidad del ARNm son un factor, no pueden explicar el cambio de & gt50 veces en la expresión de CDS aguas abajo ya que las tasas de traducción de CDS aguas arriba se variaron sistemáticamente.

Luego, realizamos comparaciones cuantitativas entre estas mediciones y cálculos biofísicos para determinar si un solo modelo podría explicar cómo el cambio de la tasa de traducción de CDS ascendente controla las tasas de traducción de CDS descendente. Primero, utilizamos estas medidas para determinar el valor del coeficiente de despliegue asistido por ribosomas, C, que relaciona la velocidad de los ribosomas que se alargan corriente arriba con la fracción de tiempo que un ribosoma ha desplegado una estructura de ARN. El parámetro C controla la inclinación de la curva sigmoidea que relaciona las tasas de traducción de los CDS ascendentes y descendentes a través del mecanismo de iniciación de novo. Determinamos que C es 0,81 ± 0,17 normalizando las 76 mediciones de fluorescencia de GFPmut3b, restando las tasas de reinicio como fuente de acoplamiento traslacional y encontrando el valor de mejor ajuste de C que minimizó la diferencia entre las mediciones normalizadas y las tasas de iniciación de traducción de CDS descendentes pronosticadas. El ajuste de este único parámetro dio como resultado predicciones precisas de la tasa de iniciación de la traducción para el CDS descendente en las 76 mediciones con un promedio de Pearson. R 2 de 0,78 (Figura 3C). Por el contrario, si el mecanismo de acoplamiento traslacional no se incluyó dentro del modelo biofísico, entonces las predicciones del modelo no fueron comparables a las tasas de traducción medidas (promedio R 2 = 0.01) (Figura complementaria S3).

Observamos que cambiar la región intergénica podría tener un efecto proporcional sobre la cantidad absoluta de expresión de CDS aguas abajo más allá del mecanismo observado de acoplamiento traduccional. Utilizando el modelo biofísico para distinguir las interacciones conocidas de las desconocidas, encontramos que dos de las seis regiones intergénicas tenían niveles de expresión de Gfpmut3b sobrepredichos con un cambio proporcional máximo de 7,2 veces en todas las tasas de traducción de CDS ascendentes.

Predicción de tasas de acoplamiento traslacional en operones tri-cistrónicos

Además, evaluamos las predicciones del modelo biofísico mediante el diseño, la construcción y la caracterización de 44 variantes de operón tri-cistrónico empleando los indicadores CFP, mRFP1 y GFPmut3b. Se construyeron cuatro conjuntos diferentes de regiones intergénicas donde la primera región intergénica entre CFP y mRFP1 contenía dos estructuras de ARN inhibitorias diferentes con ΔGRAMOacoplamiento energías de −14,5 y −9,1 kcal / mol, mientras que la segunda región intergénica entre mRFP1 y GFPmut3b contenía estructuras de ARN inhibidoras con ΔGRAMOacoplamiento energías de −12,6 y −5,3 kcal / mol. Para aumentar sistemáticamente la expresión de los CDS más aguas arriba, diseñamos e insertamos 11 sitios de unión de ribosomas sintéticos que controlan la expresión de CFP con tasas de inicio de traducción de 10 a 268 000 en la escala proporcional de la calculadora RBS. Luego, monitoreamos los niveles de expresión de CFP, mRFP1 y GFPmut3b de las 44 variantes del operón durante cultivos prolongados mantenidos en la fase de crecimiento exponencial, y registramos las distribuciones de fluorescencia de una sola célula mediante citometría de flujo (sección "Materiales y métodos").

A medida que aumentaron las tasas de traducción de CDS aguas arriba, el acoplamiento de traducción entre CFP y mRFP1 aumentó la expresión de mRFP1 entre 10,5 y 31,3 veces (Figura 4). Simultáneamente, el acoplamiento de traducción entre mRFP1 y GFPmut3b aumentó la expresión de GFPmut3b entre 41,8 y 83,3 veces. Las relaciones entre las tasas de traducción de CDS ascendentes y descendentes fueron bien predichas por los cálculos del modelo biofísico (Figura 4).

Medidas de expresión de operones tri-cistrónicos. Las regiones intergénicas de cuatro operones tri-cistrónicos se diseñaron y caracterizaron racionalmente para evaluar las predicciones del modelo biofísico. (líneas azules) Predicciones de modelos biofísicos utilizando C = 0,81 y kPAG = 10 se muestran junto (círculos negros) las mediciones del nivel de expresión de los reporteros CFP, mRFP1, GFPmut3b como el cfp las tasas de traducción aumentan sistemáticamente. Δ calculadoGRAMOacoplamientoGRAMOsin acoplamiento) las energías libres para las dos regiones intergénicas son (A) −14,5 (−15,4) y −12,6 (−16,3) (B) −9,1 (−16,5) y −5,3 (−20,1) (C) −14,5 (−15,4) y −5,3 (−20,1) (D) −9,1 (−16,5) y −12,6 (−16,3) kcal / mol. Todos tienen distancias intergénicas D = −4. Los valores y las barras de error son la media y la DE de al menos dos repeticiones.

Medidas de expresión de operones tri-cistrónicos. Las regiones intergénicas de cuatro operones tri-cistrónicos se diseñaron y caracterizaron racionalmente para evaluar las predicciones del modelo biofísico. (líneas azules) Predicciones de modelos biofísicos utilizando C = 0,81 y kPAG = 10 se muestran junto (círculos negros) mediciones de nivel de expresión de los reporteros CFP, mRFP1, GFPmut3b como el cfp las tasas de traducción aumentan sistemáticamente. Δ calculadoGRAMOacoplamientoGRAMOsin acoplamiento) las energías libres para las dos regiones intergénicas son (A) −14,5 (−15,4) y −12,6 (−16,3) (B) −9,1 (−16,5) y −5,3 (−20,1) (C) −14,5 (−15,4) y −5,3 (−20,1) (D) −9,1 (−16,5) y −12,6 (−16,3) kcal / mol. Todos tienen distancias intergénicas D = −4. Los valores y las barras de error son la media y la DE de al menos dos repeticiones.

Específicamente, los niveles de expresión de CFP aumentaron proporcionalmente a la tasa de iniciación de la traducción de sus secuencias de RBS diseñadas (promedio R 2 = 0,67) (Figura 5A D), excepto a una tasa de traducción de 268 000 au donde la expresión alcanzó una meseta. Para predecir el mRFP1 tasas de traducción, las previstas cfp tasas de traducción y cfp-mRFP1 La secuencia intergénica se introdujo en el modelo biofísico de acoplamiento traslacional (ecuaciones (1-5)) utilizando los valores de los parámetros previamente determinados (C = 0.81, kPAG = 10). En comparación con los niveles de expresión medidos, el modelo biofísico predijo con precisión mRFP1 tasas de traducción en una escala proporcional (promedio R 2 = 0.82) (Figura 5B E), particularmente para las regiones intergénicas que produjeron niveles de expresión más altos (Figura 4A C D), donde el Pearson R 2 comparaciones fueron 0,94 (PAG = 3 × 10 −6 ), 0.91 (PAG = 2 × 10 −5) y 0,90 (PAG = 3 × 10 −5). los gfpmut3b Las tasas de iniciación de la traducción se predijeron utilizando el mismo enfoque que el previsto mRFP1 tasas de traducción y mRFP1-gfpmut3b secuencia intergénica se introdujeron en el modelo biofísico y las tasas de inicio de traducción de gfpmut3b fueron calculados. En comparación con los niveles de expresión medidos, el modelo biofísico también pudo predecir con precisión gfpmut3b tasas de traducción en una escala proporcional (promedio R 2 = 0,73) (Figura 5C F). Como antes, excluir el mecanismo de acoplamiento traslacional del modelo biofísico resultó en una fuerte reducción en la precisión. mRFP1 y gfpmut3b las tasas de traducción no se predijeron bien (R 2 valores & lt 0.01) (Figura complementaria S4). En general, la incorporación del acoplamiento traslacional en el modelo biofísico fue esencial para predecir con precisión las tasas de iniciación de la traducción dentro de los operones multicistrónicos.

Predicciones de modelos biofísicos para operones tri-cistrónicos. (A) Una comparación entre las medidas de expresión de operones tricistrónicos y las predicciones del modelo biofísico de acoplamiento traslacional sin utilizar un factor de proporcionalidad. (B) La misma comparación se realiza después de multiplicar las tasas de conversión previstas por factores de proporcionalidad como se muestra. Pearson promedio R 2 valores de comparación son 0,67, 0,82 y 0,73, de izquierda a derecha respectivamente, y no se modifican por el valor del factor de proporcionalidad. Los colores representan las variantes del operón (negro) pTTTd-4-15-13, (rojo) pTTTd-4-9-5, (verde) pTTTd-4-15-5 y (azul) pTTTd-4-9-13. Los valores y las barras de error son la media y la DE de al menos dos repeticiones.

Predicciones de modelos biofísicos para operones tri-cistrónicos. (A) Una comparación entre las medidas de expresión de operones tricistrónicos y las predicciones del modelo biofísico de acoplamiento traslacional sin utilizar un factor de proporcionalidad. (B) La misma comparación se realiza después de multiplicar las tasas de conversión previstas por factores de proporcionalidad como se muestra. Pearson promedio R 2 valores de comparación son 0,67, 0,82 y 0,73, de izquierda a derecha respectivamente, y no se modifican por el valor del factor de proporcionalidad. Los colores representan las variantes del operón (negro) pTTTd-4-15-13, (rojo) pTTTd-4-9-5, (verde) pTTTd-4-15-5 y (azul) pTTTd-4-9-13. Los valores y las barras de error son la media y la DE de al menos dos repeticiones.

Es importante destacar que, aunque los operones bi-cistrónicos y tri-cistrónicos tienen secuencias 5 ′ UTR e intergénicas claramente diferentes, así como órdenes de genes, el modelo fue capaz de predecir sus tasas de iniciación de la traducción con una precisión similar. Por ejemplo, la adición del cfp La secuencia de codificación de la proteína como primer gen dentro del operón tri-cistrónico alteró el inicio de la traducción de la UTR 5 'al permitir la formación de estructuras de ARNm que inhibían la unión del ribosoma. Estos cambios en la tasa de traducción de CDS ascendente luego se propagaron hacia adelante a través del acoplamiento de traducción para afectar las tasas de traducción de ambos mRFP1 y gfpmut3b CDS. Al cuantificar las fortalezas de las interacciones moleculares que controlan el inicio de la traducción y el acoplamiento traduccional, el modelo pudo explicar estos cambios significativos en la secuencia y la arquitectura del operón.

Luego realizamos un análisis de sensibilidad sobre el factor de conversión entre el ensamblaje del ribosoma y la tasa de reinicio (kPAG) y la constante de despliegue asistida por ribosomas (C) para determinar cómo el cambio de sus valores alteró las predicciones de la tasa de iniciación de la traducción del modelo. Cuantificamos el rango de valores de parámetros que arrojaron predicciones de tasa de traducción dentro del intervalo de confianza del 95%, utilizando las 120 variantes de operón bi-cistrónico y tri-cistrónico, totalizando 360 niveles de expresión acoplados traslacionalmente, como medidas experimentales. Descubrimos que los valores de mejor ajuste para kPAG y C fueron 14 y 0,81, respectivamente, y que los rangos de confianza del 95% para estos parámetros fueron [8,33] y [0,67,1] (Figura complementaria S5). Cambiar el valor de C, basado en las mediciones del operón bicistrónico, no mejoró la capacidad del modelo para predecir las tasas de iniciación de la traducción en los operones tricistrónicos. Del mismo modo, el valor de mejor ajuste de kPAG en gran medida de acuerdo con la medición anterior de kPAG que se basó en mediciones separadas de expresión mono-cistrónica mRFP1 y GFPmut3b.

Sin embargo, encontramos que las modificaciones de las regiones intergénicas tenían un efecto sobre los niveles de expresión absoluta de los CDS aguas abajo dentro de los operones tri-cistrónicos (Figura 5).Por ejemplo, después de tener en cuenta las diferencias predichas por el modelo en las tasas de traducción, hubo una disminución de 8 veces en la expresión de mRFP1 a todas las tarifas de traducción de cfp ascendentes (Figura 5B) cuando la horquilla de ARN inhibidor en el cfp-mRFP1 La región intergénica tenía un tallo acortado (Figura 4A versus Figura 4D). Esta modificación de la región intergénica cfp-mRFP1 también redujo la expresión de GFPmut3b en todos los niveles aguas arriba cfp tasas de traducción en 4,5 veces, aunque la región intergénica mRFP1-gfpmut3b no se modificó. Las reducciones en la expresión de mRFP1 y GFPmut3b, independientemente de la cfp tasa de traducción, sugirió la presencia de otras interacciones que tienen un efecto multiplicativo en la expresión de proteínas (por ejemplo, cambios en la estabilidad del ARNm). La magnitud de estas interacciones se cuantifica mediante un factor de proporcionalidad aparente K.

Por el contrario, si el mRFP1-gfpmut3b región intergénica se modificó dejando la cfp-mRFP1 región intergénica sin cambios, los niveles de expresión de GFPmut3b disminuyeron solo en un factor de 2,3 en todo el cfp tasas de traducción, mientras que los niveles de expresión de mRFP1 fueron en gran medida similares (cambio de 1,45 veces) (Figura 4A frente a Figura 4C). Por lo tanto, los factores adicionales que controlan los cambios proporcionales en el nivel de expresión, más allá del acoplamiento de traducción, eran específicos de secuencia y solo se encuentran aquí dentro de la primera región intergénica. En general, en las cuatro regiones intergénicas, los niveles absolutos de mRFP1 y gfpmut3b Los niveles de expresión diferían de las predicciones del modelo en como máximo un factor proporcional de 13,85 y 10,2 veces, respectivamente (Figura 5D E F). Estas diferencias en el factor de proporcionalidad cuantifican las magnitudes de las interacciones, más allá del acoplamiento de traducción, que pueden afectar los niveles de expresión de CDS descendentes, pero no se incluyen en el modelo. A continuación, discutimos cómo la incorporación de mecanismos reguladores de genes adicionales en los operones puede explicar los cambios en el factor de proporcionalidad aparente.

Predicción del acoplamiento traslacional en un operón natural

Los avances en los ensayos basados ​​en secuenciación de próxima generación han permitido mediciones cuantitativas de los niveles de ARNm y la ocupación de ribosomas en el transcriptoma de un organismo (37, 45). En particular, las técnicas de perfilado de ribosomas y RNA-Seq se aplicaron recientemente a E. coli MG1655 para determinar sus niveles de ARNm en todo el genoma y la ocupación de ribosomas en medios MOPS completos, mínimos y sin metionina (38). Aquí, aplicamos nuestro modelo biofísico de iniciación de la traducción y acoplamiento traduccional para predecir las tasas de iniciación de la traducción de las secuencias codificantes dentro de un operón natural y compararlas con estas mediciones de todo el genoma.

Antes de estas comparaciones, es importante examinar los tipos de datos generados por estas técnicas basadas en secuenciación y analizar los supuestos necesarios para comparar estas mediciones con las predicciones del modelo. Primero, las mediciones de RNA-Seq se informan típicamente usando unidades de lecturas por kilobase de mRNA por millón de lecturas (RPKM). La unidad RPKM tiene en cuenta las diferencias en la longitud de CDS y la cobertura de secuenciación, y proporciona una medida proporcional de la concentración de ARNm, aunque la RPKM promedio en un transcriptoma variará de un organismo a otro (46). Por lo tanto, las mediciones del nivel de ARNm en unidades de RPKM existen en una escala proporcional.

De manera similar, la técnica de elaboración de perfiles de ribosomas registra el número de ribosomas unidos a las transcripciones de ARNm, que se promedia a lo largo de la longitud de un CDS para proporcionar números de ribosomas a nivel de gen. El número medio de ribosomas por transcripción de ARNm se puede cuantificar dividiendo estos números de ribosomas a nivel de gen por mediciones de nivel de ARNm, lo que arroja una métrica cuantitativa para la densidad de ribosomas a nivel de gen. Sin embargo, la conversión de densidades de ribosomas a tasas de traducción de ARNm depende de las tasas de elongación y de iniciación de la traducción del ARNm, lo que confunde una comparación directa entre las densidades de ribosomas medidas y las tasas de inicio de traducción predichas por el modelo. En cambio, en el análisis inicial de las mediciones de perfiles de ribosomas (38), se asumió que todos E. coli los genes tienen las mismas tasas de elongación de traducción, aunque esta suposición nunca fue validada experimentalmente y no es probable que sea cierta. En particular, las densidades de ribosomas medidas para el 90% de E. coli los genes variaron sólo 11,8 veces. Si las tasas de elongación de la traducción fueran las mismas para todos los genes, eso implicaría que las tasas de iniciación de la traducción solo variarían 11,8 veces en todo el transcriptoma, lo que tampoco es probable que sea cierto. Por lo tanto, solo deberíamos comparar las densidades de ribosoma medidas con las tasas de iniciación de la traducción predichas cuando haya motivos para sospechar que las secuencias codificantes dentro de un operón tienen tasas de elongación de traducción aproximadamente iguales.

Seleccionamos el atpIBEFHAGDC operón como se usó previamente como ejemplo ilustrativo (38) y porque codifica nueve secuencias codificantes sin ningún promotor interno conocido o terminadores transcripcionales. Las proteínas Atp se unen para formar un gran complejo multimérico, compuesto por el complejo ATP sintasa F0 (AtpBE10F2) y el complejo ATP sintasa F1 (AtpHA3GD3C) y, por lo tanto, es más probable que tengan tasas de elongación de traducción sincronizadas y similares. Por consiguiente, el número medido de ribosomas unidos a cada CDS fue aproximadamente proporcional a las estequiometrías proteicas esperadas dentro del complejo de ATP sintasa. Por ejemplo, el número de ribosomas unidos a la transcripción para atpE fue 10,7 veces mayor que atpB como resultado de un nivel de ARNm 2,4 veces mayor y una ocupación de ribosoma 4,4 veces mayor por transcripción. En particular, porque el atp El operón presenta nueve genes y cuatro estequiometrías de proteínas diferentes, proporciona un mayor número de puntos de datos únicos para la comparación que otros operones.

Cuando se utiliza el sitio de inicio transcripcional medido experimentalmente en sentido ascendente de atpI y el codón de inicio GUG más traducido para atpI, el modelo biofísico fue capaz de predecir con precisión el inicio de la traducción y las tasas de acoplamiento traslacional para todos atp genes en comparación con las densidades de ribosomas medidas (R 2 = 0.72, PAG = 0,004) (Tabla 1). Cuando el acoplamiento traslacional no se incluyó en el modelo, las tasas de inicio de traducción para atpF y atpA se predijeron con menos precisión (R 2 = 0.65, PAG = 0,008) la reiniciación del ribosoma es responsable del 98% de atpF iniciación de la traducción, y la región intergénica para atpA contiene una estructura de ARN inhibidora superpuesta (ΔGRAMOacoplamiento = −5,9 kcal / mol) que aumenta su tasa de iniciación de la traducción en 6,5 veces. En general, el modelo biofísico de iniciación de la traducción y acoplamiento traslacional podría explicar por qué las tasas de síntesis de proteínas de la atpIBEFHAGDC operón son proporcionales a las estequiometrías proteicas esperadas.

Acoplamiento traslacional en el atp operón

Gene. Cuenta de lectura de ribosomas (au). recuentos de lectura de ARNm (RPKM). Ribosomas por transcripción (au). Transl. en eso. tasa (con acoplamiento). Transl. en eso. tasa (sin acoplamiento). Factor de acoplamiento.
atpI 151 764 0.20 0.014 0.014 1.00
atpB 10508 1695 6.20 2.47 2.47 1.00
atpE 112959 4114 27.46 27.73 27.56 1.01
atpF 17866 3109 5.75 1.98 0.034 57.63
atpH 9335 2938 3.18 2.75 2.15 1.28
atpA 30696 2724 11.27 4.61 0.71 6.54
atpG 9832 1914 5.14 4.88 4.55 1.07
atpD 30603 2177 14.06 4.80 4.46 1.08
atpC 12695 2193 5.79 12.60 12.26 1.03
Gene. Cuenta de lectura de ribosomas (au). recuentos de lectura de ARNm (RPKM). Ribosomas por transcripción (au). Transl. en eso. tasa (con acoplamiento). Transl. en eso. tasa (sin acoplamiento). Factor de acoplamiento.
atpI 151 764 0.20 0.014 0.014 1.00
atpB 10508 1695 6.20 2.47 2.47 1.00
atpE 112959 4114 27.46 27.73 27.56 1.01
atpF 17866 3109 5.75 1.98 0.034 57.63
atpH 9335 2938 3.18 2.75 2.15 1.28
atpA 30696 2724 11.27 4.61 0.71 6.54
atpG 9832 1914 5.14 4.88 4.55 1.07
atpD 30603 2177 14.06 4.80 4.46 1.08
atpC 12695 2193 5.79 12.60 12.26 1.03

Las tasas de iniciación de traducción predichas del modelo biofísico con y sin acoplamiento se comparan con las mediciones de densidad de ribosomas a nivel de gen, obtenidas previamente por Li et al. ( 38).

Gene. Cuenta de lectura de ribosomas (au). recuentos de lectura de ARNm (RPKM). Ribosomas por transcripción (au). Transl. en eso. tasa (con acoplamiento). Transl. en eso. tasa (sin acoplamiento). Factor de acoplamiento.
atpI 151 764 0.20 0.014 0.014 1.00
atpB 10508 1695 6.20 2.47 2.47 1.00
atpE 112959 4114 27.46 27.73 27.56 1.01
atpF 17866 3109 5.75 1.98 0.034 57.63
atpH 9335 2938 3.18 2.75 2.15 1.28
atpA 30696 2724 11.27 4.61 0.71 6.54
atpG 9832 1914 5.14 4.88 4.55 1.07
atpD 30603 2177 14.06 4.80 4.46 1.08
atpC 12695 2193 5.79 12.60 12.26 1.03
Gene. Cuenta de lectura de ribosomas (au). recuentos de lectura de ARNm (RPKM). Ribosomas por transcripción (au). Transl. en eso. tasa (con acoplamiento). Transl. en eso. tasa (sin acoplamiento). Factor de acoplamiento.
atpI 151 764 0.20 0.014 0.014 1.00
atpB 10508 1695 6.20 2.47 2.47 1.00
atpE 112959 4114 27.46 27.73 27.56 1.01
atpF 17866 3109 5.75 1.98 0.034 57.63
atpH 9335 2938 3.18 2.75 2.15 1.28
atpA 30696 2724 11.27 4.61 0.71 6.54
atpG 9832 1914 5.14 4.88 4.55 1.07
atpD 30603 2177 14.06 4.80 4.46 1.08
atpC 12695 2193 5.79 12.60 12.26 1.03

Las tasas de iniciación de traducción predichas del modelo biofísico con y sin acoplamiento se comparan con las mediciones de densidad de ribosomas a nivel de gen, obtenidas previamente por Li et al. ( 38).

Criterios de diseño para regiones intergénicas para coordinar la expresión en operones sintéticos

Usando el modelo biofísico, ahora analizamos cómo se pueden diseñar regiones intergénicas para coordinar la expresión de proteínas dentro de los operones bacterianos sintéticos. Nuestras aplicaciones de interés incluyen la coexpresión de proteínas de múltiples subunidades y vías de múltiples enzimas. En primer lugar, las tasas de traducción de CDS aguas arriba y aguas abajo de un operón estarán relacionadas linealmente cuando una región intergénica no tiene ninguna estructura de ARN inhibidora que se superponga con la huella de los ribosomas que se alargan aguas arriba (ΔGRAMOacoplamiento = 0). Debido al reinicio del ribosoma, la pendiente de esta relación está controlada por la distancia intergénica entre estos CDS y varía entre cero y 0,022. La pendiente relativamente pequeña puede tener un gran efecto en las proporciones del nivel de expresión de proteínas cuando los CDS ascendentes y descendentes tienen tasas de traducción basal muy diferentes según lo cuantificado por las interacciones del ribosoma con el ARNm (ΔGRAMOfinal - ΔGRAMOsin acoplamiento). Por ejemplo, cuando un CDS ascendente tiene una tasa de traducción basal 100 veces mayor que un CDS descendente (distancia intergénica D = −4), solo habrá una diferencia de 31 veces en la tasa de traducción cuando se tenga en cuenta la reiniciación del ribosoma. Para evitar tales efectos, las regiones intergénicas deben diseñarse de modo que las secuencias codificantes se superpongan en 25 o más nucleótidos.

En segundo lugar, una vez que una región intergénica contiene estructuras de ARN inhibidoras superpuestas, las proporciones del nivel de expresión de proteínas del operón están controladas por las energías de despliegue de las estructuras (cuantificadas por ΔGRAMOacoplamiento), la tasa de traducción basal (determinada por ΔGRAMOfinal - ΔGRAMOsin acoplamiento) y la tasa de reinicio del ribosoma. Una región intergénica con una alta tasa de traducción basal (ΔGRAMOfinal - ΔGRAMOsin acoplamiento = −20 kcal / mol) y una estructura de ARN débil (ΔGRAMOacoplamiento = −5 kcal / mol) variará el ribosoma de novo tasa de iniciación en ~ 10 veces a medida que aumenta la tasa de traducción de CDS ascendente (Figura 6A). A medida que la estructura del ARN se vuelve más estable, la tasa de traducción basal del CDS descendente cae sustancialmente y solo aumentará si el CDS ascendente está altamente traducido. En principio, el acoplamiento traslacional puede incrementar la traducción de un CDS aguas abajo en 1000 veces si la estructura del ARN inhibidor es muy estable y está completamente desplegada por los ribosomas que se alargan aguas arriba.

Parámetros de acoplamiento traslacional que controlan las proporciones de proteínas. (A) Tasas pronosticadas de tasas de traducción de CDS ascendentes y descendentes como Δ de una región intergénicaGRAMOacoplamiento la energía es variada. (B) La relación prevista entre las tasas de conversión y ΔGRAMOacoplamiento cuando (ΔGRAMOfinal - ΔGRAMOno-acoplamiento) es -20 kcal / mol. (C) La relación prevista entre las tasas de conversión y ΔGRAMOacoplamiento cuando (ΔGRAMOfinal - ΔGRAMOno-acoplamiento) es -10 kcal / mol. Los círculos y las barras representan las desviaciones medias y estándar de las predicciones cuando se evalúan en un rango de 10 000 veces mayor de tasas de traducción de CDS ascendentes.

Parámetros de acoplamiento traslacional que controlan las proporciones de proteínas. (A) Tasas pronosticadas de tasas de traducción de CDS ascendentes y descendentes como Δ de una región intergénicaGRAMOacoplamiento la energía es variada. (B) La relación prevista entre las tasas de conversión y ΔGRAMOacoplamiento cuando (ΔGRAMOfinal - ΔGRAMOno-acoplamiento) es -20 kcal / mol. (C) La relación prevista entre las tasas de conversión y ΔGRAMOacoplamiento cuando (ΔGRAMOfinal - ΔGRAMOno-acoplamiento) es -10 kcal / mol. Los círculos y las barras representan las desviaciones medias y estándar de las predicciones cuando se evalúan en un rango de 10 000 veces mayor de tasas de traducción de CDS ascendentes.

En tercer lugar, se pueden diseñar regiones intergénicas para obtener las proporciones de niveles de expresión de proteínas deseadas mediante la introducción de estructuras de ARN inhibidoras con energías de plegamiento dirigidas. Variando ΔGRAMOacoplamiento, se puede lograr una amplia gama de proporciones de niveles de expresión de proteínas (Figura 6B). En particular, a una alta tasa de traducción basal (ΔGRAMOfinal - ΔGRAMOsin acoplamiento = −20 kcal / mol), las proporciones del nivel de expresión de proteínas se pueden ajustar de 2 a 70 veces cuando se modula ΔGRAMOacoplamiento de −5 a −30 kcal / mol. En cambio, cuando se diseñan regiones intergénicas con una tasa de traducción basal baja (ΔGRAMOfinal - ΔGRAMOsin acoplamiento = −10 kcal / mol), se logra una sintonización similar cuando se varía ΔGRAMOacoplamiento de −1 a −15 kcal / mol.


Abstracto

La síntesis de ARN mensajero bacteriano (ARNm) por la ARN polimerasa (RNAP) y la traducción de primera ronda por el ribosoma a menudo se acoplan para regular la expresión génica, sin embargo, no se comprende bien cómo se establece y mantiene el acoplamiento. Aquí, desarrollamos enfoques bioquímicos y de fluorescencia de una sola molécula para probar la dinámica de las interacciones RNAP-ribosoma en un ARNm con una preQ traduccional1riboswitch de detección en su región no traducida 5 '. Enlace de preQ1 conduce a la oclusión del sitio de unión al ribosoma (RBS), inhibiendo el inicio de la traducción. Demostramos que el RNAP colocado dentro de la región líder del ARNm promueve la unión de la subunidad 30S del ribosoma, antagonizando preQ1-inducida por la oclusión de RBS, y que los factores de transcripción puente RNAP-30S NusG y RfaH mejoran claramente el reclutamiento y la retención de 30S, respectivamente. Además, encontramos que, mientras que la interacción 30S-ARNm impide significativamente el RNAP en ausencia de traducción, un ribosoma de traducción activa promueve la transcripción productiva. Surge un modelo en el que la estructura del ARNm y los factores de transcripción se coordinan para modular dinámicamente la eficiencia del acoplamiento transcripción-traducción.


Ver el vídeo: Control expresión Genética en Procariotas (Febrero 2023).