Información

¿Cómo se adquiere el microbioma intestinal estratificado apropiadamente en organismos que realizan transmisión horizontal?

¿Cómo se adquiere el microbioma intestinal estratificado apropiadamente en organismos que realizan transmisión horizontal?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Estoy estudiando la transmisión horizontal de simbiontes primarios en la reproducción de insectos. Esto me recordó una pregunta anterior que había hecho, en la que supe que los humanos adquirían de forma análoga sus microbiomas particulares. También se sabe cómo el intestino humano se puede estratificar en contenido microbiano a lo largo del tracto digestivo. Mi pregunta es ¿Qué mecanismos se emplean para garantizar que los organismos que adquieren sus microbiomas de fuentes externas a través de la transmisión horizontal adquieran los microorganismos correctos en las partes correctas del intestino?? Como el metagenoma del intestino humano muestra "homología" entre individuos, se puede suponer con seguridad que el proceso no puede deberse a una casualidad.


tl; dr realmente podría deberse principalmente a una casualidad aleatoria, en términos de mecanismos intencionales al menos.

Una cosa que es importante recordar sobre el tubo intestinal es que las condiciones de vida de la microflora varían dramáticamente de un extremo al otro. Esto se aplica a la disponibilidad de nutrientes, el pH y la carga antimicrobiana. Por ejemplo, la carga bacteriana del tracto intestinal inferior es aproximadamente siete órdenes de magnitud mayor que el tracto gastrointestinal superior (estómago). Son lugares completamente diferentes.

En algunos casos, puede intentar imputar el ensamblaje bacteriano en alguna parte del intestino a una causa biológica específica proporcionada por el huésped, por ejemplo, el papel de las sales biliares en el control de qué organismos pueden colonizar ciertos lugares.

Pero una explicación más parsimoniosa es que las bacterias están creciendo en los lugares donde son buenas para crecer. Esto trae a colación el viejo dicho ecológico: "Todo está en todas partes, pero el medio ambiente elige". No somos necesariamente difícil explícitamente para reforzar un cierto ensamblaje, es solo el ensamblaje que funciona en nichos con pH muy bajo, carga de nutrientes muy alta, sales biliares, etc. Y la mayoría de esas características son consecuencias inevitables de la función principal del intestino, la digestión / excreción.

Ciertamente no parece que, p. Ej. Las estrategias de comportamiento para exponerse a los microbios "correctos" le llevan a los microbios correctos en los lugares correctos. Recuerde que el trasplante de microbioma fecal es una de las estrategias más exitosas; simplemente tome un poco de excremento saludable y colóquelo en el tracto gastrointestinal de una persona enferma, ¡mejorará! Esa no es una estrategia de transmisión horizontal muy controlada.

Podría proponer que se está llevando a cabo una selección de segundo orden en la que hemos construido nichos de IG de tal manera que fomentan ciertos ensamblajes. Ciertamente, la disbiosis ocurre y es mala en casos como p. Ej. C. difficile, nos gustaría evitarlos. Probablemente algunos Se ha producido una coevolución entre el huésped y el microbio, por ejemplo, las respuestas inmunitarias y la producción de butirato. Ese artículo de Foster tiene algunos ejemplos más de posibles mecanismos para un par de casos específicos, por ejemplo, el moco. Pero probablemente no sean suficientes para explicar la compartimentación completa del microbioma de la forma que parece estar preguntando.


Los antibióticos como amigos y enemigos del microbioma intestinal humano: el enfoque de la comunidad microbiana

Teresa Nogueira, cE3c - Centro de Ecologia, Evolução e Alterações Ambientais, Faculdade de Ciências, Universidade de Lisboa, 1749-016 Lisboa, Portugal.

cE3c - Centro de Ecologia, Evolução e Alterações Ambientais, Faculdade de Ciências, Universidade de Lisboa, Lisboa, Portugal

Institut de Systématique, Evolution, Biodiversité (ISYEB), Sorbonne Université, Muséum National d'Histoire naturelle, CNRS, EPHE, CP, París, Francia

cE3c - Centro de Ecologia, Evolução e Alterações Ambientais, Faculdade de Ciências, Universidade de Lisboa, Lisboa, Portugal

Teresa Nogueira, cE3c - Centro de Ecologia, Evolução e Alterações Ambientais, Faculdade de Ciências, Universidade de Lisboa, 1749-016 Lisboa, Portugal.

cE3c - Centro de Ecologia, Evolução e Alterações Ambientais, Faculdade de Ciências, Universidade de Lisboa, Lisboa, Portugal

Institut de Systématique, Evolution, Biodiversité (ISYEB), Sorbonne Université, Muséum National d'Histoire naturelle, CNRS, EPHE, CP, París, Francia

Abstracto

La exposición del intestino humano a los antibióticos puede tener un gran impacto en la salud humana. Los antibióticos pertenecen a la preservación de la salud humana y son herramientas útiles para combatir las infecciones bacterianas. Pueden utilizarse para curar infecciones y pueden desempeñar un papel fundamental en pacientes inmunodeprimidos o crónicos, o en la lucha contra la desnutrición grave infantil. Sin embargo, la diversidad genómica y filogenética del intestino humano cambia bajo la exposición a antibióticos. Los antibióticos también pueden tener efectos secundarios graves en la salud intestinal humana, debido a la propagación de rasgos genéticos de resistencia a los antibióticos potenciales y a su correlación con la virulencia de algunos patógenos bacterianos. Pueden dar forma, e incluso alterar, la composición y la diversidad funcional del microbioma intestinal humano. Tradicionalmente, las resistencias bacterianas a los antibióticos se han evaluado a nivel de clones o poblaciones. Sin embargo, la comprensión de estas dos perspectivas aparentemente dispares como amigos y enemigos puede provenir del estudio de los microbiomas en su conjunto y de la evaluación de los efectos positivos y negativos de los antibióticos en la dinámica y la diversidad de la comunidad microbiana. En esta revisión presentamos algunas herramientas y bases de datos metagenómicas que permiten el estudio de la resistencia a antibióticos en metagenomas intestinales humanos, promoviendo el desarrollo de estrategias de medicina personalizada, nuevos protocolos de terapia antimicrobiana y seguimiento de pacientes.


Introducción

La microbiota oral necesita hacer frente a las perturbaciones físicas y químicas diarias derivadas de la ingesta de alimentos y las medidas de higiene personal. Estos incluyen fluctuaciones en la temperatura, el pH, los componentes antimicrobianos y dietéticos, y las fuerzas mecánicas puras del cepillado y la masticación. Curiosamente, un microbioma estable a largo plazo se mantiene en la cavidad oral, como lo demostraron Rasiah y sus colegas al seguir a un donante de saliva individual durante un período de 7 años (Rasiah et al., 2005). Datos recientes del Proyecto de Microbioma Humano de los NIH (HMP) revelaron que el microbioma oral tiene el núcleo más grande de microbios comúnmente compartidos entre individuos no relacionados en comparación con otros hábitats como el intestino o la piel (Costello et al., 2009 Li et al., 2013 Zhou et al., 2013).

Una pregunta clave es ¿qué rige la estabilidad del microbioma oral en la salud? Las propiedades biológicas que confieren estabilidad al microbioma son importantes para la prevención de la disbiosis y un cambio microbiano hacia una enfermedad, por ejemplo, periodontitis o caries y el mantenimiento de la salud general (para una revisión, ver Wade, 2013). Aunque los procesos que subyacen a las enfermedades bucales se han estudiado ampliamente (Bartold y Van Dyke, 2013 Bradshaw y Lynch, 2013 Nyvad et al., 2013 Belibasakis, 2014), los procesos detrás del mantenimiento de un microbioma normal son poco conocidos. En esta revisión presentamos nuestra hipótesis sobre cómo se adquiere y mantiene un microbioma oral sano. Comenzamos por definir qué constituye un microbioma oral normal. A continuación, presentamos nuestra hipótesis sobre los mecanismos para adquirir un microbioma normal estable. Finalmente, discutimos algunos de los mecanismos involucrados en el mantenimiento de tal microbioma y destacamos las direcciones para una posible investigación adicional.


Métodos

El flujo de trabajo de MetaCHIP se presenta en la Fig. 1. MetaCHIP utiliza enfoques filogenéticos y de mejor coincidencia para la detección de HGT (ver arriba). Sus entradas son los archivos de secuencia de un conjunto de genomas o contenedores de genomas derivados de datos metagenómicos, así como sus clasificaciones taxonómicas. La herramienta GTDB-Tk recientemente desarrollada [17], que se basa en la base de datos de taxonomía del genoma calibrada filogenéticamente (GTDB) [18], se recomienda para la clasificación taxonómica de los genomas de entrada. Los genomas de entrada se agrupan inicialmente por MetaCHIP de acuerdo con sus clasificaciones taxonómicas en el rango especificado por el usuario (por ejemplo, clase, orden, familia o género).

Enfoque de la mejor combinación

Los marcos de lectura abiertos (ORF) se predicen a partir de los genomas de entrada con Prodigal v2.6.3 [19], y se realiza una búsqueda BLASTN [20] de todos contra todos entre todos los ORF predichos. Los resultados de BLASTN se filtran primero con la longitud de alineación definida por el usuario (por ejemplo, 200 pb) y los límites de cobertura (por ejemplo, 75%). Las coincidencias filtradas se comparan luego entre grupos de genomas mediante los siguientes pasos. Aquí, suponemos que todos los genomas de entrada se dividen en tres grupos (A, B y C), con los genomas individuales denominados Ax, By y Cz, respectivamente (Fig. 1). Los genes de cada genoma se representan como Ax_N, By_N y Cz_N. Tomemos el gen A1_01 como ejemplo, el número de sus coincidencias BLASTN de los grupos A, B y C es m, nyo, respectivamente, con sus identidades correspondientes siendo IHacha, IPor y yoCz. Las identidades promedio de los partidos de cada grupo son IAutomóvil club británico, IAB y yoC.A., respectivamente (Fig. 1). A continuación, se realizan los siguientes análisis para cada gen (aquí como ejemplo con A1_01):

Si yoAutomóvil club británico es el máximo, lo que significa que todas sus mejores coincidencias provienen del grupo propio, entonces el gen A1_01 no es candidato para HGT.

Si yoAutomóvil club británico = 0 (es decir, solo se encontró la auto-coincidencia del grupo A), entonces se ignorarán todas las coincidencias BLASTN de otros grupos. Esto se debe a que, si el sujeto no autoguiado con máxima identidad se consideró candidato a HGT, es muy probable que sea un falso positivo debido a la falta de coincidencias autoguiadas.

Si yoAutomóvil club británico ≠ 0 y yoAutomóvil club británico no es el máximo, entonces el grupo no propio con la identidad promedio máxima (por ejemplo, IAB o yoC.A.) será considerado como un grupo candidato putativo para HGT.

La coincidencia de BLASTN con la máxima identidad en el grupo de candidatos se considerará el candidato de HGT putativo.

Se resume la distribución de la identidad de todos los genes entre el grupo propio y el grupo candidato putativo. Se calcula el límite de identidad correspondiente al percentil predefinido (por ejemplo, el 10% más alto). Solo se considerarán más a fondo los candidatos putativos de HGT que tengan identidades superiores a este límite.

Análisis de regiones que flanquean supuestos HGT

El algoritmo de ensamblaje basado en gráficos de DeBruijn (por ejemplo, SOAP [21], Velvet [22], SPAdes [23], IDBA [24]) producirá "burbujas" para las regiones de secuencia con error de secuenciación, pero alta similitud [25]. La resolución de tales burbujas puede producir dos contigs con secuencias superpuestas al final de los contigs. Esta duplicación podría considerarse falsamente en el análisis de HGT y, para evitar esto, se descartan los candidatos de HGT putativos ubicados en el extremo de contigs con alta similitud (& gt 95%). Además, los candidatos de HGT putativos ubicados en contigs, que tenían el 95% de su coincidencia de longitud completa con un contig más largo, fueron ignorados, ya que estos contigs son probablemente duplicados artificiales del proceso de ensamblaje.

Para corroborar aún más los candidatos HGT predichos, sus secuencias flanqueantes dentro de la longitud definida por el usuario (por ejemplo, 10 kbp) se extraen de los archivos de anotaciones. Se realiza un BLASTN por pares entre cada par de regiones flanqueantes. Los gráficos de las regiones genómicas se generan con GenomeDiagram [26] y se proporcionan para inspección visual (Fig. 2).

Salida de ejemplo para las regiones flanqueantes de un HGT identificado. Los genes codificados en la hebra delantera se muestran en azul claro y los genes codificados en la hebra inversa se muestran en verde claro. Los nombres de los genes que se predice que son HGT están resaltados en azul, con una fuente grande con la identidad por pares entre paréntesis. Los nombres de contig se proporcionan en la parte inferior izquierda de las pistas de secuencia, y los números que siguen al nombre de contig se refieren a las distancias entre el gen sujeto a HGT y el extremo izquierdo o derecho del contig. Las barras rojas muestran similitudes de las regiones coincidentes entre los contigs según los resultados de BLASTN

Enfoque filogenético

Se utiliza un enfoque filogenético para corroborar aún más los resultados dados por el enfoque de mejor coincidencia y para proporcionar información sobre la dirección del flujo de genes. Para cada par de genes, que se identificaron como supuestos HGT mediante el enfoque de mejor coincidencia, se genera un árbol de proteínas utilizando los genes utilizados para el análisis de HGT en el enfoque de mejor coincidencia y todos los ortólogos de los dos grupos, de los cuales se emparejaron los genes vinieron. Las secuencias de aminoácidos se alinean con MAFFT v7.310 [27] y, a continuación, se eliminan las columnas representadas por & lt 50% de proteínas y / o con un consenso de aminoácidos & lt 50%. Luego se construye un árbol de proteínas usando FastTree v2.1.10 [28] con parámetros predeterminados.

A continuación, se genera un árbol de "especies" para compararlo con el árbol genético. Como el gen 16S rRNA, que es el marcador filogenético y taxonómico más comúnmente utilizado de organismos bacterianos y arqueales, a menudo falta en los contenedores del genoma [29,30,31], construimos un árbol filogenético para todos los genomas de entrada utilizando las secuencias de proteínas de 43 genes universales de copia única (SCG) utilizados por CheckM [32]. Las secuencias de proteínas previstas para los genomas de entrada se buscan para los perfiles PFAM v31.0 [33] y TIGRFAM v14.0 [34] hmm de estas proteínas SCG utilizando HMMER v3.1b2 [35]. A continuación, las secuencias de proteínas para cada perfil hmm se alinean individualmente usando HMMER y se concatenan en una alineación de secuencia múltiple (MSA). Se eliminan las columnas representadas por & lt 50% de genomas y / o con un consenso de aminoácidos & lt 25%, y se construye un árbol filogenético utilizando FastTree [28]. Un subárbol, que incluye solo los genomas relevantes para los genes particulares analizados, se extrae con la longitud de la rama preservada utilizando ETE v3.1.1 [36]. La reconciliación entre cada par de árbol de proteínas y subárbol de "especies" se realiza utilizando Ranger-DTL v2.0 con modo fechado. Brevemente, Ranger-DTL predice HGT mediante la realización de una reconciliación de duplicación-transferencia-pérdida (DTL) entre una filogenia de la familia de proteínas y su filogenia del organismo correspondiente [15].

Para evaluar qué tan confiables son los árboles de proteínas SCG para reconstruir filogenias de organismos a partir de contenedores de genoma parcial, seleccionamos 20 genomas de proteobacterias alfa y beta (ver más abajo) y dividimos cada uno de ellos en 100 contigs de igual longitud. A continuación, se seleccionaron aleatoriamente 20, 40, 60 y 80 contigs para representar grupos de genoma con 20, 40, 60 y 80% de completitud, respectivamente. Las similitudes entre los árboles de proteínas SCG con estos diferentes niveles de completitud y el árbol basado en secuencias de genes de ARNr 16S se evaluaron mediante pruebas de Mantel [37].

Evaluación de MetaCHIP en conjuntos de datos simulados

El desempeño de MetaCHIP se evaluó primero en conjuntos de datos simulados en diferentes niveles taxonómicos. Para evaluar su desempeño a un nivel taxonómico bajo, diez genomas de especies del género Esfingobio (grupo de donantes) y Sphingomonas (grupo de destinatarios) dentro de la familia Sphingomonadaceae fueron seleccionados (ver Archivo adicional 1: Tabla S1), mientras que para las transferencias de nivel de clase, se eligieron diez genomas alfaproteobacterianos (grupo donante) y betaproteobacterianos (grupo receptor) (ver Archivo adicional 1: Tabla S2). Se seleccionaron diez genes (con al menos dos ortólogos en el grupo receptor) de cada uno de los diez genomas del donante y se transfirieron aleatoriamente a los diez genomas receptores con diferentes niveles de divergencia genética (0, 5, 10, 15, 20, 25 y 30 %) utilizando HgtSIM [38]. Se añadió la secuencia del codón de parada de seis marcos "TAGATGAGTGATTAGTTAGTTA" a los dos extremos de los genes transferidos para facilitar la predicción correcta del gen. Este proceso se inició diez veces, y los genomas del donante y del receptor mutado de cada arranque se utilizaron directamente como entradas en MetaCHIP para evaluar su rendimiento a nivel de clase y género.

También se simularon lecturas de secuenciación de los diez genomas alfaproteobacterianos y diez betaproteobacterianos mutados para cada nivel de divergencia genética de uno de los diez bootstraps. Las lecturas de secuenciación para cada nivel de divergencia genética se simularon tres veces con diferentes perfiles de abundancia (archivo adicional 1: Tabla S3) utilizando GemSIM [39].

Como la reconstrucción de genes implicados en HGT se ve muy afectada por la profundidad de secuenciación o el ensamblador utilizado [38], se simularon 3, 6, 9 y 12 millones de lecturas, correspondientes a una cobertura media de aproximadamente 6, 11, 17 y 23 × para cada nivel de divergencia genética. Las lecturas de los extremos emparejados se filtraron por calidad utilizando Trimmomatic v0.36 [40] con un corte de calidad de 20 y una ventana deslizante de 6 pb. Las lecturas de las 3 réplicas se combinaron y luego se ensamblaron con IDBA_UD v1.1.1 [24] o metaSPAdes v3.9.0 [23], y los contigs se filtraron con un corte de longitud de 2500 bp. Se consideró que una transferencia génica se reconstruía durante el proceso de ensamblaje, si al menos 1 de las 2 regiones flanqueantes del gen era & gt 1 kpb y la región flanqueante coincidía con el genoma receptor [38]. La existencia de transferencias de genes en los contigs filtrados se analizó realizando un BLASTN por pares entre los genes transferidos y los contigs para cada nivel de divergencia genética. A continuación, los resultados de BLASTN se filtraron con un límite de identidad de & gt 98% y un límite de cobertura de & gt 98% para los genes transferidos.

El binning del metagenoma se realizó con MetaBAT v0.32.5 [1] y MyCC v2017 [2], y los resultados se refinaron con Binning_refiner v1.2 [41]. La integridad y la contaminación del contenedor se evaluaron con CheckM v0.9.7 [32]. Las correlaciones entre los bins del genoma y los genomas de referencia se obtuvieron ejecutando búsquedas BLASTN por pares. Las correlaciones entre las HGT predichas por MetaCHIP y las transferencias de genes simuladas conocidas se determinaron ejecutando búsquedas BLASTN por pares con un límite de identidad y cobertura de & gt 98%.

Evaluación de MetaCHIP en un conjunto de datos con HGT descritos anteriormente

El rendimiento de MetaCHIP también se evaluó en 2094 genomas bacterianos completos, que se analizaron previamente para detectar HGT utilizando bloques de ADN casi idéntico (& gt 99% de identidad, más de 500 pb) en genomas relacionados lejanamente (similitud del gen del ARNr 16S inferior al 97%) [42] . Los 2094 genomas bacterianos se descargaron de la base de datos NCBI RefSeq, y su taxonomía se determinó utilizando GTDB-Tk v0.1.6 [17]. Los eventos de HGT luego se analizaron con MetaCHIP a nivel de género. Se utilizó la búsqueda BLASTN con una identidad del 100% y un límite de cobertura para comparar las HGT predichas por MetaCHIP con bloques de ADN transferidos previamente identificados. La anotación del COG de los HGT predichos se realizó ejecutando RPS-BLAST [20] contra la base de datos del COG [43].

Evaluación de MetaCHIP en un conjunto de datos metagenómicos reales

Se utilizaron contenedores de genoma derivados de conjuntos de datos metagenómicos para microbiomas de intestinos humanos [1, 44] y muestras de agua de mar tomadas en el Mar del Norte [45] para evaluar el rendimiento de MetaCHIP en conjuntos de datos metagenómicos reales.Para el conjunto de datos del intestino humano, los contenedores del genoma previamente producidos por MetaBAT [1] se usaron directamente aquí después de eliminar los contigs de menos de 2000 pb. Para el conjunto de datos del Mar del Norte, todas las lecturas de secuenciación se filtraron por calidad con Trimmomatic como se describió anteriormente [45] y se ensamblaron usando metaSPAdes v3.9.1. El agrupamiento se realizó como se describió anteriormente. Posteriormente se utilizó CheckM v0.9.7 para evaluar la calidad de los contenedores del genoma. El árbol de proteínas SCG de estos contenedores y la anotación del COG de los HGT predichos se realizaron como se describió anteriormente, y los COG relacionados con la resistencia a los antibióticos se recuperaron de la Base de datos de genes de resistencia a los antibióticos (ARDB, abril de 2018) [46].


Resultados

La composición de la vía taxonómica y funcional converge en una conformación similar a la de un donante después de una terapia exitosa

En 2013 se realizó un ensayo multicéntrico de RBX2660 para la ICD recurrente. Se consintió a cuarenta personas y 31 pacientes completaron el ensayo de 6 meses (archivo adicional 1: Fig. S1) [25]. Dos pacientes tuvieron una frecuencia de muestreo insuficiente y, por lo tanto, fueron excluidos de nuestro análisis, lo que dejó a 29 individuos cuyos ciclos temporales de síntomas de ICD, administración de RBX2660 y recepción de antibióticos se muestran en la figura 1. Doce pacientes no experimentaron una recurrencia de ICD después de una dosis única de la estudio (intervención única o grupo SI) mientras que 17 experimentaron una recurrencia entre el día 7 y el día 60. Los 17 pacientes con CDI recurrente recibieron una intervención repetida con antibióticos y / o RBX2660 repetida (grupo RI Fig.1 ID del paciente texto rojo mediana 15 días posteriores al RBX2660 inicial). Los participantes que recibieron una segunda dosis de RBX2660 no fueron necesariamente pretratados con antibióticos antes según el protocolo del estudio (archivo adicional 1: Fig. S1) [25]. Primero determinamos longitudinalmente la composición taxonómica de la microbiota intestinal después de la primera dosis de RBX2660 [27] (Fig. 1, panel izquierdo). Utilizamos la secuenciación del gen ARNr 16S analizada mediante DADA2 [38] y la distancia UniFrac ponderada calculada del donante (DFD), que sirve como métrica del injerto [45]. Después del primer tratamiento del estudio, el DFD de la microbiota muestra una tendencia decreciente con el tiempo después del tratamiento, lo que indica una mayor similitud con la composición de la microbiota del donante, pero esto difiere según el resultado final del tratamiento (Fig. 2a). En el momento 0, no hubo diferencia en la mediana de DFD entre los pacientes que respondieron a una dosis única (SI) y los que recibieron una intervención repetida (RI) para CDI recurrente (pag & gt 0,05, Mann-Whitney U prueba). Sin embargo, el día 7 después del primer tratamiento del estudio, la DFD de la microbiota fue significativamente mayor para las personas que finalmente recibieron la intervención repetida después del día 7 para la CDI recurrente (Figura 2b, mediana de 0,31 frente a 0,22, Mann-Whitney U prueba, pag & lt 0,05). Por lo tanto, la adopción de perfiles de microbiota similares a los de los donantes el día 7 después del primer tratamiento del estudio es un factor predictivo significativo del éxito del injerto de la terapia inicial durante el período de observación. Aunque la DFD parece disminuir para el grupo de IR en el día 60 (Fig. 2a), esta observación solo se basa en los 4/17 individuos que aún no han experimentado la recurrencia de la CDI. Estos datos demuestran que en los primeros tratamientos exitosos, el perfil general de la microbiota del paciente cambia rápidamente para parecerse a los donantes después del tratamiento del estudio. Sin embargo, la convergencia nunca es absoluta para estos pacientes durante la duración del estudio, con un DFD medio de 0,179 a los 180 días después del primer tratamiento del estudio (fig. 2a). Este grado de injerto es coherente con lo que se ha informado anteriormente en la bibliografía sobre los TMF [22, 46].

Además, investigamos el impacto de la terapia de restauración derivada de la microbiota en la microbiota fecal del paciente mediante la secuenciación completa de escopeta metagenómica con perfiles tanto taxonómicos como funcionales [27]. Cada uno de los cuatro donantes contribuyó con 2-8 muestras para un total de 21 muestras de donantes individuales (archivo adicional 1: Fig. S2). La microbiota del donante estaba dominada por Firmicutes, que se espera en adultos estadounidenses sanos [47], mientras que la microbiota receptora antes de RBX2660 tenía una mayor abundancia de Proteobacteria, que es un sello distintivo de la microbiota alterada por antibióticos [48, 49] (Archivo adicional 1 : Fig. S2). Para explorar estos datos, se realizó un análisis de componentes principales. Los PCA de la Fig. 3a yb se visualizaron solo para injertos exitosos (grupo SI), que revelaron comunidades de microbiota distintas entre los donantes y los receptores en el día 0 (como se indica mediante elipses de confianza del 95% que no se superponen en la Fig. 3a), pero no después. A continuación, determinamos las vías funcionales de todo el microbioma para el grupo SI según se infiere utilizando HUMAnN2 [44] (Fig. 3b). De manera similar a la composición taxonómica, el PCA de las diversas vías funcionales encontradas en estos pacientes con tratamientos exitosos fueron significativamente diferentes (elipses de confianza del 95% no superpuestas, Fig. 3b) de las de los donantes sanos solo en el punto de tiempo basal. También utilizamos Análisis Discriminante Lineal con LEfSe para identificar características discriminatorias a los 7 días indicativos de recibir una mayor intervención [50] (Archivo adicional 1: Fig. S3). Este análisis identificó las vías microbianas para la membrana y los procesos biosintéticos se enriquecieron en los respondedores después de la primera dosis. Los individuos que requerían reintervención (grupo RI) tenían funciones microbianas enriquecidas para flagelos, patogénesis y unión de iones. Para obtener una imagen más clara de las trayectorias cambiantes a lo largo del tiempo, cada una de las vías de HUMAnN2 se trazó por separado con cada uno de los pares del día 0 y del día 7 (archivo adicional 1: Fig. S4). Estos se han agrupado según la dirección del cambio después del tratamiento (es decir, si un grupo de tratamiento en particular se enriqueció o se agotó para una vía específica después del tratamiento). Por lo tanto, es posible que ciertas funciones microbianas se restauren después del tratamiento inicial (archivo adicional 1: Fig. S4), pero los pacientes aún sufren recurrencia de CDI. Por lo tanto, la probabilidad de un tratamiento exitoso con RBX2660 se correlaciona con la convergencia taxonómica y funcional a una conformación más parecida a la de un donante.

La taxonomía y las vías funcionales microbianas convergen después de recibir la terapia. a, B Análisis de componentes principales (PCA) de la composición taxonómica del microbioma del paciente a partir de datos 16S (a) y de las abundancias de vías funcionales de la secuenciación metagenómica completa (B) en el grupo SI. Cada punto de color representa una muestra fecal individual después de la primera intervención con el círculo que representa el intervalo de confianza del 95% con círculos que no se cruzan, por lo tanto, estadísticamente significativo. Panel a muestra 96 ​​muestras de los doce pacientes con tratamiento exitoso y los cuatro donantes, mientras que el panel B muestra 52 muestras de ocho pacientes exitosos y cuatro donantes (todos los que pasaron los filtros de calidad de secuenciación de escopeta). C PCA desde el punto de tiempo 7 muestras después del primer tratamiento del estudio solamente, coloreadas por el grupo SI o RI (46 muestras de todos los donantes y todos los pacientes con muestras del día 7 del paciente norte = 25 donante norte = 4). Cada muestra está conectada al centroide de su grupo de resultados por un segmento del mismo color. D El biplot de taxonomía muestra los vectores de influencia de los taxones para distinguir las muestras del día 7. Las muestras de entrada, los ejes y el origen son los mismos que en C

Los taxones clave discriminan a aquellos pacientes que requieren una intervención repetida

Para identificar los taxones microbianos específicos correlacionados con el resultado del tratamiento, utilizamos PCA para visualizar las diferencias en la composición taxonómica basada en el gen del ARNr 16S, según lo inferido por DADA2, entre las muestras del día 7 del receptor estratificadas por el resultado final, así como las muestras de los donantes para su comparación (Fig. 3c). El resultado de DADA2 son las variantes de secuencia de amplicones (ASV), que pueden diferir en tan solo 1 nucleótido y se ha demostrado que mejoran la especificidad y sensibilidad de la identificación de organismos [38, 51, 52]. Los ASV se numeraron en orden de prevalencia general dentro de todas las muestras para mayor claridad. En el día 7, los pacientes que posteriormente recibieron una intervención repetida de antibióticos o terapia repetida con RBX2660, el grupo RI, mostraron una composición taxonómica significativamente diferente en comparación con el grupo SI (Adonis, pag = 0,028) o los donantes (Adonis, pag = 0,001) (figura 3c). Los taxones identificados por PCA que impulsan la diferencia entre las posiciones del centroide incluyeron 25 ASV por encima del 5% de importancia y 11 por encima del 10% de importancia (Fig. 3d). Los vectores etiquetados con taxonomía influyen en las muestras de la Fig.3c alejándose del origen en la dirección indicada, por lo que los vectores que apuntan en la dirección del centroide del donante representan taxones de donantes importantes, los vectores en la dirección del grupo SI identifican características importantes de el éxito después de la terapia inicial y los vectores que apuntan hacia el centroide del grupo RI identifican características correlacionadas con la necesidad de tratamiento adicional. En este análisis PCA de taxones a los 7 días, los géneros Blautia y Roseburia fueron los más representativos de los donantes y el éxito después de la terapia inicial (SI), y los ASV representaron a los miembros del género Escherichia/Shigella, Klebsiella, y Pluralibacter se asociaron más con la probabilidad de requerir una nueva intervención (Fig. 3d). Tres ASV separados del Akkermansia género proporcionó una gran parte de la variación, y en algunas muestras gravemente perturbadas en los días 0 y 7, A. muciniphila ASV 2 superó el 40% de la composición microbiana total (archivo adicional 1: Fig. S5). Sin embargo, después del día 30, A. muciniphila ASV 2 a menudo mantuvo una abundancia estable de & lt 25% en el grupo SI, mientras que la abundancia en el grupo RI fue muy variable después de la reintervención (archivo adicional 1: Fig. S5B). La replicación del PCA a través de la función dpcoa de phyloseq volvió a mostrar Akkermansia contribuyendo con la variación, pero sin correlacionarse con el resultado del tratamiento (archivo adicional 1: Fig. S6). De nota, C. difficile no estaba entre los principales indicadores. Su correspondiente ASV así como C. difficile Los genes de toxina, detectados a través de marcadores ShortBRED personalizados (archivo adicional 1: Fig. S7A), fueron & lt 2% de abundancia relativa en cualquier muestra y no se correlacionaron con el resultado del tratamiento (archivo adicional 1: Fig. S7B).

Con base en los hallazgos de nuestro análisis de PCA, caracterizamos temporalmente la abundancia relativa de estos 11 ASV más discriminatorios a lo largo del tiempo después del primer tratamiento para el grupo SI (Fig. 4). Para los sujetos que no tuvieron recurrencia de CDI (el grupo SI), los ASV de los donantes incluyen Roseburia ASV7, Blautia ASV 1 y 3, y Anaerostipes ASV8 estuvo notablemente ausente en las muestras del día 0 (Fig. 4). Para el día 7, estos taxones aumentaron en abundancia relativa y, al final del ensayo, el día 180, su abundancia fue similar a la del microbioma donante. Por el contrario, los ASV correspondientes a Enterobacteriaceae, Escherichia, Akkermansia, y Klebsiella fueron abundantes en el tiempo 0 para los receptores y su abundancia disminuyó con el tiempo. Por tanto, los taxones asociados con un primer tratamiento exitoso con RBX2660 (Fig. 3d) comienzan a cambiar la abundancia relativa a los 7 días después de la primera dosis con la adopción continuada de una conformación más parecida al donante durante los 180 días siguientes. A los 30 días después del primer fármaco del estudio, 14/17 del grupo de IR ya habían sufrido una recurrencia de CDI y habían recibido un segundo FMT o antibióticos (Fig. 1). Por lo tanto, no podemos investigar si las diferencias de abundancia relativa en puntos de tiempo posteriores a los 7 días también estarían asociadas con el éxito. Sin embargo, dadas las tendencias en los cambios de abundancia relativa, es probable que una mayor adopción de una conformación similar a la de un donante también se asocie con el éxito (Fig. 4). Hemos identificado varios taxones 7 días después de RBX2660 (Fig. 3d) cuya presencia y cambios de abundancia relativa durante los primeros 180 días se asocian con la limitación de la recurrencia de CDI.

Los taxones se asociaron significativamente con la distancia del donante y la respuesta exitosa a RBX2660. Se muestra un mapa de calor que demuestra la abundancia relativa a lo largo del tiempo después del primer RBX2660 para los donantes y el grupo SI. Estos taxones son los 11 principales identificados por el PCA en la Fig. 3d como significativamente asociados con un tratamiento exitoso. El azul oscuro corresponde al 0.001% de abundancia relativa con un azul más claro al 0.1% de abundancia relativa. Cada columna representa una muestra de un paciente a lo largo del tiempo de izquierda a derecha con muestras de donantes a la derecha. norte = 109 muestras de 12 sujetos del grupo SI y 4 donantes

La restauración de la microbiota reduce concomitantemente los organismos resistentes a los antibióticos y los genes de resistencia a los antibióticos

La resistencia a los antibióticos en las comunidades intestinales del donante y del receptor en cualquier momento se detectó tanto por cultivo selectivo y diferencial como por anotación de ARG a partir de datos de secuenciación de escopeta metagenómica y secuencias del genoma completo ensambladas de cultivos aislados [35]. El cultivo selectivo y diferencial produjo 38 aislamientos de ARO (5 Enterobacter, 3 E. coli, 3 Citrobacter, 2 Pluralibacter, 19 Enterococcus faeciumy 6 Enterococcus faecalis) identificado por espectrometría de masas de vuelo por ionización por desorción láser asistido por matriz (MALDI-TOF MS) y confirmado mediante análisis genómico [27] (archivo adicional 2). Los perfiles de susceptibilidad a los antibióticos (Fig. 5a-e) revelaron resistencia a 9 de 13 antibióticos probados en 5 géneros, medida por el ensayo de difusión en disco. Luego se creó un árbol filogenético de todos los aislamientos para demostrar la relación evolutiva y se poda para mostrar cada aislado mostrado con las secuencias disponibles públicamente más estrechamente relacionadas.

Los organismos resistentes a los antibióticos cultivados a partir de heces de pacientes y donantes y los correspondientes ASV de las especies se rastrearon a lo largo del tiempo. ami Perfiles de susceptibilidad antibiótica para cada organismo cultivado de cualquier muestra de donante y paciente con el árbol filogenético correspondiente. Todos los puntos de corte en la concentración de antibióticos se determinaron según los criterios de CLSI 2016. Las etiquetas taxonómicas se derivan de asignaciones DADA2 ASV, con Enterobacter se especifica más a partir del nivel de familia en función de las asignaciones de taxonomía metaphlan2 y MALDI-TOF. La designación A indica receptor y D indica donante. El siguiente número indica el número de identificación del estudio seguido del momento del aislamiento. A y E connotan colonias individuales en placas separadas. Fj Cada uno de los ASV correspondientes a la especie en ami se muestran en relativa abundancia a lo largo del tiempo en 131 muestras fecales de 28 pacientes y 4 donantes después del primer tratamiento del estudio. *pag & lt 0.05, **pag & lt 0.01 para las diferencias de abundancia relativa 7 días después de la terapia entre los grupos SI y RI usando Mann-Whitney U prueba. TMP-SMX, trimetoprim-sulfametoxazol

Enterobacter (Figura 5a), Escherichia (Figura 5b), Citrobacter (Fig. 5c), y Pluralibacter (Fig. 5d) demostró resistencia fenotípica a la amoxicilina, así como a las cefalosporinas de 1ª y 3ª generación. Múltiple E. coli los aislados también demostraron resistencia a gentamicina, doxiciclina y cloranfenicol (Fig. 5b). Es importante destacar que, dadas las preocupaciones de seguridad recientes con respecto a la bacteriemia causada por BLEE E. coli después de FMT [53], identificamos E. coli en un donante resistente a amoxicilina, cefazolina y ceftriaxona, indicativo de producción de BLEE (Fig. 5b). Afortunadamente, ninguno de los pacientes que recibieron este producto experimentó una infección invasiva por E. coli [25]. También identificamos la realidad virtual Enterococcus faecalis y Enterococcus faecium presente en 8 pacientes a lo largo del curso del estudio (fig. 5e). La anotación de los 41 genomas ensamblados con ARG conocidos a través de Resfinder detectó 350 genes de resistencia que predicen la resistencia a todas las clases principales de antibióticos (archivo adicional 3). Si bien el objetivo de este estudio no fue encontrar o evaluar genotipos causales que expliquen la resistencia empírica, los ARO generalmente siguieron estas reglas: los aislados con resistencia a los antibióticos amoxicilina y cefalosporina se asociaron típicamente con bla genes mientras dfra1, aac / aadA1, y floR correspondían a la resistencia a trimetoprima-sulfametoxazol, resistencia a la gentamicina y resistencia al cloranfenicol, respectivamente (archivo adicional 3). No se observó resistencia a meropenem y el aislado único con resistencia a ciprofloxacina no tenía un marcador genómico conocido asociado. La cohorte en este estudio albergaba una carga sustancial de ARG y ARO, y buscamos rastrear estas especies longitudinalmente a través de un muestreo metagenómico más profundo.

Las especies correspondientes a las 38 ARO aisladas son causas comunes de infección asociada a la asistencia sanitaria, a menudo son resistentes a múltiples fármacos y pueden participar en la transferencia horizontal de genes entre comensales y otros patógenos dentro del intestino y el medio ambiente [54,55,56]. Debido a que la secuenciación tiene el potencial de ser más sensible en la detección fecal de estos organismos que el cultivo bacteriano [57], buscamos rastrear estas especies dentro de las muestras dentro de nuestra cohorte. En consecuencia, los ASV asociados con cada ARO aislado que identificamos fueron mapeados reconstruyendo genes de rRNA en aislados secuenciados, realizando in silico PCR para obtener secuencias de genes de rRNA 16S y anotándolas con DADA2 (Fig. 5). Los ASV correspondientes a cada ARO cultivado (Fig. 5a-e) se rastrearon a lo largo del tiempo después del primer fármaco de estudio (Fig. 5f-j). La abundancia relativa de los ASV representados en la Fig. 5f-j representan múltiples cepas relacionadas con secuencias idénticas de ARNr 16S, que de manera demostrable contienen todos los ARO cultivados pero también pueden representar subpoblaciones susceptibles. Sin embargo, con una excepción, todos estos ASV estaban ausentes en los donantes tanto por cultivo como por metagenómica, lo que les permitió medir de manera confiable la trayectoria de los ASV asociados con el paciente. El ASV correspondiente a los cultivados E. coli se encontraron aislamientos en un donante y se identificó metagenómicamente en un donante (donante 1-1-DP) con una abundancia del 0,1%. En consecuencia, los dos pacientes (ID de paciente A2 y A26) que recibieron ese producto no se consideraron para el análisis de erradicación para ese ASV porque no podemos distinguir entre los derivados del donante E. coli y derivado del receptor E. coli. Dada la reciente alerta de la FDA de resistentes E. coli infecciones después de recibir FMT [58], confirmamos que ninguno de estos pacientes desarrolló infecciones invasivas por este organismo. Excluyendo el ARO de origen del donante y los receptores compatibles, la muestra de cada uno de los demás receptores que cultivó un ARO también fue positiva mediante secuenciación metagenómica, lo que valida esta técnica de mapeo. Sin embargo, el cultivo detectó ARO de estas especies en solo 26/111 (23,4%) de los casos en los que ese ASV se identificó en los metagenomas. Esto puede reflejar diferencias en la viabilidad del aislamiento en las muestras fecales almacenadas, ya que las células muertas producirán una detección positiva basada en ADN. Alternativamente, esto también puede reflejar que los ASV para estas especies incluyen tanto ARO como formas de estas bacterias susceptibles a los antibióticos. Por lo tanto, con este enfoque, los ASV identificados representan un límite superior para la detección de estos ARO potenciales en los metagenomas.

Después de la primera dosis de RBX2660, la abundancia relativa de cada ASV basado en aislamientos disminuyó drásticamente (Fig. 5f-j).Para cada uno de estos ASV encontrados en la muestra más antigua de un individuo (norte = 61 positivos / 130 en total), si ese ASV era indetectable en la última muestra del paciente, se consideraba erradicado. Según esta métrica, el 41/61 o el 67% de estas especies fueron erradicadas (archivo adicional 4). Durante el curso de este estudio, 5 ASV que fueron negativos en ambos donantes y en los primeros momentos del paciente se volvieron positivos posteriormente (3 Enterobacter ASV 15, 2 Escherichia ASV 4). Estos se consideraron indetectablemente de baja abundancia por secuenciación metagenómica o adquiridos ambientalmente.

A pesar de la disminución temprana que observamos para los ASV correspondientes a Enterococcus, Escherichia, y Enterobacter, algunos pacientes mostraron posteriores aumentos variables en su abundancia a lo largo del tiempo (Fig. 5f, g, j). Sus respectivas tasas de erradicación fueron 7/8 (87%), 9/22 (40%) y 7/10 (70%). Sin embargo, Pluralibacter y Citrobacter ambos permanecieron en abundancias extremadamente bajas (& lt 1% y .02%, respectivamente) después del agotamiento inicial (Fig. 4h, i), con tasas de erradicación de 5/6 (83%) y 7/7 (100%), respectivamente. Curiosamente, a pesar de la tendencia hacia la disminución de ARO independientemente del resultado del primer tratamiento, encontramos una diferencia significativa en la abundancia relativa de ambos Escherichia (Figura 5g, pag & lt 0.01) y Pluralibacter (Figura 5i, pag & lt 0,05) ASV entre los grupos SI y RI a los 7 días después del tratamiento. Este hallazgo corrobora los análisis anteriores de que las fuertes disminuciones en estos géneros pueden estar asociadas con el éxito, mientras que el aumento de la abundancia a los 7 días se correlaciona con la probabilidad de falla de RBX2660. Después del segundo fármaco del estudio en el grupo RI, los ASV correspondientes a Escherichia, Citrobacter, y Enterococcus no disminuyó tan drásticamente con niveles variables a partir de entonces, especialmente para Escherichia (Archivo adicional 5: Fig. S8). El seguimiento de ASV en muestras metagenómicas nos permitió evaluar cuantitativamente la máxima abundancia posible de estos posibles organismos causantes de infecciones asociados con la atención médica. Es importante destacar que este método de seguimiento de ASV no mide simultáneamente la resistencia fenotípica a los antibióticos. Como se mencionó anteriormente, si los pacientes portaban cepas susceptibles estrechamente relacionadas que no se encontraron en los donantes sanos, estas podrían inflar los totales de ASV. Sin embargo, este aparente efecto de rebote en la abundancia de ARO que identificamos a través de aislamientos de secuenciación profunda es especialmente importante de considerar cuando se intenta erradicar completamente los ARO de los microbiomas de los pacientes mediante la transferencia de la microbiota del donante. Además, este método de seguimiento de los ASV de los ARO pronosticados en muestras metagenómicas es sensible y robusto a los falsos negativos, por lo que identifica la erradicación frecuente y una disminución general de los ARO después de la terapia de restauración de la microbiota. A continuación, procedimos a evaluar si el contenido y la identidad general de ARG disminuyeron de forma concomitante con la disminución de la abundancia de ARO.

La abundancia de genes de resistencia a los antibióticos disminuye con el tiempo en proporción con la adopción de la microbiota del donante

Anotamos y cuantificamos ARG en cada metagenoma de escopeta utilizando ShortBRED con marcadores ARG construidos a partir de la base de datos CARD [37]. Las familias ARG más abundantes (determinadas por el recuento de marcadores por millón de lecturas) correspondientes a las principales clases de antibióticos se eligieron para su representación en la Fig. 6a. Para cada familia de genes, la abundancia de genes normalizada de todas las muestras en el punto de tiempo 0 se comparó con todas las muestras de tratamientos exitosos (grupo SI) en el punto de tiempo 180 y con todas las muestras de donantes (Fig. 6a, b). Decidimos examinar 180 días después de la intervención porque investigaciones anteriores han demostrado la recuperación del microbioma en adultos sanos después de la exposición a antibióticos [59]. Para la vancomicina, donde se requieren múltiples genes para la resistencia funcional, el grupo mínimo completo tenía que estar presente para ser contado en este análisis. En cada familia de genes, la abundancia en el punto de tiempo 0 en los pacientes fue significativamente diferente que en los donantes y en el punto de tiempo 180, la abundancia de esa familia de genes en el paciente se había acercado más que en el donante (Fig.6a, b Wilcoxon por pares con Benjamini -Corrección de Hochberg, pag & lt 0,05). Esto no siempre fue una disminución con el tiempo. Los genes de resistencia a la tetraciclina fueron más abundantes dentro de los donantes y fueron adoptados gradualmente por los receptores (Fig. 6a). La resistencia a la tetraciclina se observa comúnmente entre individuos sanos dada la resistencia inherente de los taxones microbianos más comunes [60, 61]. Dentro de las β-lactamasas, se observaron efectos opuestos basados ​​en el origen de esos genes, donde las β-lactamasas de tipo AmpC se agotaron mientras que los genes CblA se adquirieron y enriquecieron (Fig. 6b). En conjunto, la abundancia media global de ARG disminuyó con el tiempo (Fig. 6c), pero no significativamente en aquellos pacientes que requirieron una intervención repetida ni después del segundo fármaco del estudio (Archivo adicional 5: Fig. S9). Sin embargo, el mejor factor de predicción del transporte de ARG no fue el tiempo transcurrido desde la intervención, sino el DFD de la microbiota. Observamos una correlación lineal negativa entre la adopción de la conformación de la microbiota del donante medida por el 1-DFD más cercano a 1 (que indica una mayor similitud del donante) y el transporte de ARG (Fig. 6d). Por lo tanto, la carga de ARG es paralela al progreso del injerto de RBX2660 medido por la distancia del donante basada en el gen de ARNr 16S (Fig.2), lo que muestra una correlación significativa en un modelo lineal de efectos mixtos (LR 17.68587, pag & lt 0,0001). Esta correlación general es cierta independientemente del estado del tratamiento o del origen de los ARG. Sin embargo, la disminución más fuerte se observó en los ARG de origen del paciente. No hubo relación entre la distancia del donante y los ARG no presentes en las muestras de referencia o en el donante (archivo adicional 5: Fig. S10). Las muestras de microbiota de los pacientes que cambiaban rápidamente tenían una variación de aproximadamente 1 a 2 órdenes de magnitud mayor que las muestras de donantes tomadas durante el mismo período de tiempo (archivo adicional 6). Por lo tanto, observamos una gran capacidad de la microbiota del donante para desplazar los ARG en el receptor, y la fuerza de este efecto depende del injerto de la microbiota del donante. Por lo tanto, hemos documentado la capacidad de la microbiota del donante para reducir las especies de ARO y la abundancia de ARG como beneficio colateral de RBX2660 cuando se administra con éxito para la prevención de la CDI recurrente.

La abundancia de genes de resistencia a antibióticos se correlaciona con la distancia del donante. a Los ARG se cuantificaron en secuencias metagenómicas (norte = 21 pacientes y 4 donantes) y resumido por mecanismo. Todos los recuentos de ARG se transformaron por logaritmo (ARG + 1) para mayor visibilidad. B Dos familias de genes dentro de la clase de β-lactamasa muestran trayectorias opuestas (norte = 21 pacientes y 4 donantes). C ARG de origen del paciente que se muestran a lo largo del tiempo después de RBX2660. D La abundancia de ARG se traza frente a 1- (distancia del donante) utilizando UniFrac ponderado. Un modelo de regresión logarítmica normal de efectos mixtos generalizados de la fórmula ARG

Se muestra DFD + (1 | PatientID), donde DFD fue significativamente predictivo y se correlacionó con el recuento de ARG en comparación con el modelo nulo (Chisq = 72.28, d.f. (completo) = 1, pag & lt 2,2 × 10 −16). Para C y D, todos los pacientes de ambos grupos de resultados se incluyeron para 153 muestras totales con pacientes norte = 25 y donante norte = 4. aC La significancia se determinó por pares de Wilcoxon con corrección de Benjamini-Hochberg. *pag & lt 0.05 **pag & lt 0,001


Reflexionando sobre las dos hipótesis

Aunque el paradigma del útero estéril estuvo generalmente aceptado hasta hace unos 10 años, la hipótesis alternativa está experimentando un renacimiento. Como actualmente no existe un consenso claro, a continuación evaluamos la evidencia disponible en apoyo de cada modelo. Se deben tener en cuenta varios aspectos, entre ellos, las características anatómicas, inmunológicas y fisiológicas de la placenta, el estado inmunológico del feto, las limitaciones de los métodos de investigación utilizados para estudiar las poblaciones microbianas, el microbioma durante los primeros días de vida, y la evidencia proporcionada por la generación de animales libres de gérmenes (incluidos los humanos).

A. Consideraciones anatómicas, físicas e inmunológicas

Las dos funciones principales de la placenta son la nutrición del feto y su protección contra patógenos microbianos. En consecuencia, la placenta tiene varias características anatómicas, fisiológicas e inmunológicas que previenen la colonización bacteriana.

(i) Barreras anatómicas y fisiológicas

La barrera materno-fetal contiene dos elementos anatómicamente distintos, la placenta corioalantoidea y el corioamnios. Esta barrera está formada a nivel placentario por el sincitiotrofoblasto velloso, una capa de células epiteliales especializadas diferenciadas de los citotrofoblastos mononucleares subyacentes (Fig. 2). El sincitiotrofoblasto invade activamente la pared uterina y finalmente forma el componente fetal más externo de la placenta y las vellosidades placentarias. Esta importante capa epitelial también forma una interfaz entre la sangre materna y el líquido extracelular embrionario para mediar en la transferencia de oxígeno y nutrientes entre los capilares maternos y el entorno del feto. Además, el sincitiotrofoblasto actúa como una célula continua sin barreras intercelulares, impidiendo que las células maternas o bacterianas se aprieten a través de las uniones intercelulares y lleguen al torrente sanguíneo fetal. Esto proporciona un primer nivel crítico de protección estructural contra la invasión de células maternas portadoras de antígenos extraños y patógenos bacterianos [52,53,54,55].

Representación esquemática de las barreras placentarias anatómicas, fisiológicas e inmunológicas diseñadas para limitar la invasión microbiana. Tres tipos principales de células en el lado fetal de la placenta impiden el acceso de invasores bacterianos a la circulación fetal: el sincitiotrofoblasto, los citotrofoblastos y los trofoblastos extravellosos (EVT). La membrana basal también sirve como barrera física que evita la invasión bacteriana. Además, las células inmunitarias maternas y las inmunoglobulinas (no representadas) están cerca de los EVT para ayudar en la defensa contra las agresiones microbianas.

Además, una membrana basal separa el sincitiotrofoblasto del tejido conectivo que contiene los capilares fetales (Fig. 2). Esta membrana placentaria constituye un segundo obstáculo físico que los posibles invasores microbianos deben superar para infectar al feto en desarrollo [33]. Un tercer nivel de protección lo proporcionan los trofoblastos extravellosos (EVT). Los EVT invaden la decidua y funcionan para anclar la placenta en la pared uterina [56] (fig. 2). Además de estar co-localizados con células asesinas naturales, macrófagos y leucocitos, los EVT también proporcionan mecanismos de defensa innatos [57] y poseen propiedades bactericidas [53, 55]. Es importante destacar que los EVT también envían señales tolerogénicas a los leucocitos maternos para prevenir el daño de la placenta mediado por el sistema inmunitario [57].

Juntos, el sincitiotrofoblasto, el EVT y la membrana basal constituyen la barrera física que evita el paso de bacterias al saco amniótico y, en consecuencia, al feto. Solo patógenos bacterianos genuinos (por ejemplo, Listeria monocytogenes, Brucella abortus, y Toxiplasma gondii) poseen los factores necesarios para la invasión exitosa de estas barreras, la subversión de la respuesta inmune y el establecimiento en la placenta como viable organismos. Por ejemplo, L. monocytogenes utiliza estructuras de virulencia específicas como las internalinas (InlA e InlB), la hemolisina listeriolisina O y la proteína actina inductora del ensamblaje ActA para cruzar las barreras intestinal, placentaria y hematoencefálica [58]. El requisito de que estas estructuras invadan con éxito las células de mamíferos se ha demostrado introduciéndolas en bacterias comensales utilizando vectores plasmídicos [59]. Juntos, estos hallazgos indican que solo los patógenos y no los comensales son capaces de eludir las barreras anatómicas materno-fetales y establecerse en el entorno fetal.

(ii) Barreras inmunológicas

Numerosas células inmunes y moléculas efectoras están presentes en la placenta para asegurar la protección contra invasores bacterianos. Por ejemplo, los receptores toll-like (TLR) 1 a 10, que son importantes para reconocer patrones moleculares y facilitar las respuestas inmunitarias, están presentes en la placenta humana [60, 61], y su expresión está regulada tanto espacial como temporalmente según la gestación. período [62]. Además, el aparato reproductor femenino expresa constitutivamente péptidos antimicrobianos (AMP). Estos AMP sirven como efectores inmunitarios cruciales para la placenta y las membranas fetales durante el embarazo al proporcionar una barrera química contra las infecciones ascendentes [63]. Las concentraciones de algunos AMP aumentan durante el final de la gestación, mientras que otros se liberan directamente en el líquido amniótico y el compartimento fetal durante el parto para ayudar a defender al recién nacido contra la infección [64,65,66].

Otros efectores inmunitarios importantes presentes en la placenta son las inmunoglobulinas (p. Ej., IgG, IgA e IgM), que desempeñan múltiples funciones importantes en la regulación del curso de un embarazo normal [67, 68]. En la parte materna de la placenta, las inmunoglobulinas protegen a la madre contra los antígenos paternos presentes en el feto, mientras que en la parte fetal, las inmunoglobulinas protegen al feto contra macromoléculas y agentes infecciosos que se originan en la madre [67]. Curiosamente, la mayoría de las IgG placentarias están unidas tanto a la membrana basal trofoblástica como a las superficies del sincitiotrofoblasto [69]. Por el contrario, la IgM se localiza en las estructuras vellosas placentarias [70]. En particular, todas estas inmunoglobulinas se pueden encontrar como componentes de las capas externas de la placenta, y esta ubicación es probablemente una clave para protegerse contra las bacterias que intentan obtener acceso. De hecho, la presencia de AMP en las membranas coriónica y amniótica e inmunoglobulinas en la placenta podría explicar por qué las investigaciones no han podido encontrar bacterias viables en placentas de partos sanos a término. En lugar de bacterias vivas, lo que puede estar presente en los tejidos placentarios son simplemente productos bacterianos creados por las acciones antimicrobianas de los AMP y las inmunoglobulinas.

En conjunto, el epitelio placentario posee una serie de características anatómicas, fisiológicas e inmunológicas para prevenir y combatir la amenaza microbiana. Muchos otros sitios epiteliales que albergan microbiomas residentes también tienen estas características. Sin embargo, al considerar la idea de un microbioma asociado con el feto humano, uno debe considerar que varios componentes del sistema inmunológico necesarios para facilitar una interrelación prenatal "libre de incidentes" con el microbioma aún no están en su lugar o no están maduros en el feto. Las diferencias significativas entre el sistema inmunológico neonatal y adulto incluyen una reducción en la actividad del complemento sérico, una menor capacidad para producir anticuerpos contra antígenos de polisacáridos bacterianos y un mayor número de células T vírgenes y células presentadoras de antígenos con un programa funcional naïve correspondientemente [71, 72] . Aparte de un subconjunto limitado de AMP que se expresan en distintos compartimentos fetales [66], los fetos no tienen la inmunidad necesaria para superar con éxito la invasión bacteriana. Además, los estudios que documentan las funciones inmunes limitadas de los recién nacidos muy prematuros indican que el sistema inmunológico complejo necesario para el desarrollo de tolerancia inmunológica a un microbioma no estaría presente en un feto [72, 73, 74]. Finalmente, la permeabilidad intestinal es mayor durante los primeros 2 días de vida para los recién nacidos prematuros en comparación con los recién nacidos a término sanos [75], lo que sugiere que el intestino fetal permitiría la translocación bacteriana y promovería encuentros con un sistema inmunológico subdesarrollado. Aunque puede haber alguna evidencia, aunque inconsistente, de la presencia de ADN bacteriano en muestras de líquido placentario y amniótico de embarazos sanos, no está del todo claro cómo un feto inmunológicamente inmaduro controlaría con éxito las bacterias viables para prevenir infecciones (y mortalidad) y desarrollarse normalmente.

B. Consideraciones metodológicas

La mayoría de los estudios que establecieron el paradigma del útero estéril se basan en el cultivo microbiano, que no detecta microbios viables pero no cultivables. La PCR basada en ADN y los métodos de secuenciación superan esta limitación, y es posible que las bacterias detectables por estos métodos en el entorno fetal-placentario y en el meconio representen organismos viables, metabólicamente activos, que no se pueden cultivar. Sin embargo, también se debe considerar que estos métodos moleculares tienen limitaciones inherentes. Primero, incluso si el ADN bacteriano es detectable, los organismos podrían estar muertos. Esta consideración es especialmente relevante para la placenta, ya que un papel importante para este tejido es la eliminación de microbios y sus componentes que podrían estar presentes en la sangre [76]. Además, para que la investigación desafíe con éxito el paradigma del útero estéril, es esencial una demostración de la viabilidad microbiana, ya que los sitios pueden ser estériles incluso si contienen ADN bacteriano. Muy pocos grupos han demostrado microorganismos viables en el entorno fetal a pesar de que estos estudios emplean métodos de cultivo que cultivan fácilmente bacterias de otras partes del cuerpo [77,78,79,80,81,82,83]. En el caso de Satokari y colegas [84], los autores no pudieron cultivar bacterias detectadas por métodos moleculares (Bifidobacteria y Lactobacillus) a pesar de que se trata de organismos fácilmente cultivables. Aunque los autores atribuyen este resultado a la congelación de las muestras antes del procesamiento, también consideran la posibilidad de que solo productos bacterianos, incluido el ADN, en lugar de bacterias vivas, están presentes en la placenta. De hecho, la congelación de las muestras antes del procesamiento se ha realizado en muchos estudios de microbiomas basados ​​en cultivos y, aunque reduce los recuentos de bacterias, normalmente no impide el cultivo. En el caso de Collado et al. [10], la identificación de bacterias cultivadas de la placenta y el líquido amniótico de los recién nacidos nacidos por cesárea se limitó a múltiples aislamientos de Propionibacterium y Estafilococo especies, y uno aislar cada uno de Streptomyces y Lachnospiraceae. Propionibacterium y Estafilococo Las especies son comensales de piel normal ubicuos y, por lo tanto, podrían originarse por contaminación (ver más abajo). Es importante destacar que los autores informaron que Enterobacter y Escherichia/Shigella fueron los géneros más abundantes detectados en muestras de placenta y líquido amniótico. Sin embargo, no pudieron recuperar estos organismos mediante métodos de cultivo a pesar de la relativa facilidad para cultivar estos grupos bacterianos. En conjunto, estos hallazgos y otros datos actuales no respaldan la existencia de bacterias vivas en la placenta.

Una consideración metodológica aún más importante es que las evaluaciones basadas en ADN de muestras de biomasa microbiana baja (como la placenta, el líquido amniótico y el meconio) son extremadamente propensas a confundir los hallazgos del ADN contaminante.De hecho, los estudios han demostrado que los análisis basados ​​en secuencias de muestras con niveles bajos de ADN no son confiables porque los reactivos, consumibles y componentes de los kits de extracción de ADN contienen ADN bacteriano [85,86,87,88,89,90,91]. El trabajo de Salter et al. [90] ha demostrado sistemáticamente que cuanto menor es la cantidad de ADN bacteriano en una muestra, mayor es la proporción de secuencias que pueden atribuirse a la contaminación. Los autores proporcionaron una lista de taxones bacterianos comúnmente presentes en reactivos y consumibles que se detectan en controles negativos (Fig. 3). Curiosamente, alrededor del 36% del total de especies reportadas por Aagaard y colegas [9] como “el microbioma placentario” se superponen con los taxones de esta lista. Aunque algunos investigadores informan del uso de controles, como la secuenciación de extracciones sin molde [9], incluso estos han sido criticados por no ser suficientes [76], y la mayoría de los estudios sobre la microbiota del entorno fetal-placentario no informan la uso de cualquier control [10, 38, 49, 50, 84, 92]. Claramente, la falta de controles apropiados hace que los hallazgos sobre los microbiomas fetales sean extremadamente dudosos. Esta noción fue reforzada recientemente por Lauder et al. [91], quienes compararon sistemáticamente los datos de secuenciación obtenidos de muestras de placenta con los de diferentes controles de contaminación, incluidos hisopos estériles, hisopos de aire (hisopos expuestos al aire del laboratorio clínico) y blancos de extracción de dos diferentes kits de aislamiento de ADN (tubos en blanco como fuente de posibles contaminantes de extracción / reactivo). Este estudio reveló que las muestras de placenta contenían exactamente las mismas cantidades marginales de ADN bacteriano que los blancos de extracción, y que las comunidades bacterianas detectadas se agrupaban estrechamente con la comunidad contaminante del respectivo kit de aislamiento de ADN. Más importante aún, no se identificaron linajes bacterianos como únicos o presentes en mayor abundancia en las muestras de placenta en comparación con los controles de contaminación.

Diagrama de Venn de géneros bacterianos hipotetizados para contribuir al microbioma intestinal infantil. Aagaard et al. [9] plantearon la hipótesis de que las bacterias se trasladan de la cavidad oral de la madre a la placenta, lo que contribuye a la colonización del intestino fetal en el útero. Sugieren además que las placentas contienen comunidades de baja abundancia de bacterias comensales. Sin embargo, el 36% de los géneros bacterianos encontrados por Aagaard et al. [9] también aparecen en la lista de contaminantes encontrados en los reactivos por varios grupos de investigación independientes, según lo informado por Salter et al. [90]. No se incluyeron todos los géneros para cada microbioma individual debido a limitaciones de espacio. Los géneros que se encuentran en el intestino del lactante [2, 101, 102, 105, 148] incluyen taxones descritos en bebés nacidos tanto por vía vaginal como por cesárea [101, 105] y muestran una superposición sustancial con los géneros que se encuentran en el microbioma intestinal del adulto [145,146,147] , pero poca superposición con taxones que se encuentran en la placenta [9, 91] o como contaminantes [85,86,87,88,89,90,91]

Además de prevenir la contaminación del ADN, evitar la contaminación de las muestras en sí también es un desafío importante cuando se estudian las comunidades bacterianas de baja abundancia y baja diversidad. Las muestras para el estudio del entorno intrauterino se recolectan dentro de un entorno clínico (hospital, sala de emergencias, sala de partos o quirófano), lo que dificulta, si no imposible, evitar la contaminación de la muestra durante la recolección y el procesamiento. Además, la limpieza del entorno de procesamiento de tejidos es particularmente importante en los laboratorios donde los cultivos bacterianos también se manipulan de forma rutinaria. En consecuencia, el tiempo de procesamiento y almacenamiento también parece influir en los resultados. Por ejemplo, Jiménez y sus colegas [8] informaron que sus muestras se agruparon por tiempo de procesamiento, ya que la mitad de ellas se procesaron en el momento de la recolección, mientras que el resto se procesó 4 días después de la recolección.

Además, el método de parto del lactante también puede influir en el grado de contaminación de la muestra y debe tenerse en cuenta durante el diseño del estudio. Las placentas extraídas por vía vaginal están expuestas a microbios vaginales durante la expulsión y, en nuestra opinión, los hallazgos, por lo tanto, no pueden usarse para defender la colonización en el útero, ni deben compararse con los tejidos extraídos por cesárea. Como ejemplo, Jones et al. Evaluaron los tejidos fetales y placentarios de 74 partos por cesárea y vaginales prematuros y a término [93]. Encontraron que el 30 y el 43% de estos tejidos eran positivos para ADN bacteriano usando qPCR. Sin embargo, una vez que los autores estratificaron los tejidos según el modo de administración, ninguna de las placentas de cesárea a término resultó positiva.

En general, las técnicas moleculares utilizadas para estudiar el microbioma fetal tienen limitaciones inherentes debido a su susceptibilidad a falsos positivos debido a la contaminación. A este respecto, es importante tener en cuenta el límite de ADN que puede detectarse de forma fiable mediante estos métodos. Incluso en estudios que apoyaron la presencia de un microbioma placentario, se reconoció que las concentraciones de ADN eran muy bajas [9, 10]. Por lo tanto, es probable que solo las técnicas capaces de detectar menos de 100 células bacterianas por gramo de muestra proporcionen resultados confiables. Sin embargo, incluso los métodos de PCR, a pesar de que pueden (en teoría) detectar una única plantilla de ADN, con frecuencia tienen límites de detección de 104 a 106 células por gramo cuando se aplican a muestras con matrices complejas [94, 95]. Aunque no se han establecido los límites de detección de las tecnologías de secuenciación de alto rendimiento en muestras de baja biomasa, es probable que no sean suficientes para detectar de manera confiable las bajas cantidades de ADN en estas muestras (por ejemplo, en presencia de ADN contaminante). Los métodos de cultivo poseen el límite de detección requerido, pero como se describió anteriormente, la mayoría de los estudios no arrojaron resultados positivos. Por lo tanto, llegamos a la conclusión de que la hipótesis de la colonización en el útero se basa en estudios que utilizaron enfoques moleculares con un límite de detección insuficiente para estudiar poblaciones microbianas de "baja biomasa" y además carecían de controles adecuados para la contaminación y no proporcionaron evidencia de viabilidad bacteriana.

C. Interpretación de los resultados del estudio del microbioma del recién nacido muy temprano

La detección repetida de microbios en el meconio se ofrece con frecuencia como evidencia en apoyo de la hipótesis de la colonización en el útero. Sin embargo, debe reconocerse que solo un pequeño subconjunto de meconios contiene microbios detectables [3, 12, 13, 14, 96]. Incluso si se detectan microbios, las bacterias en las primeras heces del recién nacido podrían ser el resultado de la colonización posnatal, especialmente si el meconio se expulsa mucho después del parto. Los experimentos con ratones libres de gérmenes han demostrado que la colonización bacteriana es rápida, con especies bacterianas detectables 8 h después de la exposición inicial de los ratones a un alojamiento convencional, y los recuentos bacterianos se vuelven equivalentes a los de los ratones convencionales después de 24 h [97]. Si el "ser humano libre de gérmenes" apoya el crecimiento microbiano de manera similar al de un ratón libre de gérmenes, entonces también se esperaría que ocurriera un proceso de colonización rápido en el intestino neonatal. Hansen y sus colegas [14] argumentaron que existe un “intervalo de colonización de meconio” que brinda suficiente oportunidad para que los microbios se multipliquen entre la ruptura de las membranas durante el nacimiento y el momento en que se administra y procesa el meconio. En apoyo de esta idea, se ha demostrado repetidamente que la colonización microbiana del meconio aumenta con el tiempo de paso [12, 13, 14], lo que indica que la colonización se produce ex útero. En consecuencia, los estudios que no categorizan y diferencian este período de tiempo en sus análisis reportan un mayor número de casos positivos [92, 98, 99].

Además, la composición del microbioma infantil pionero apoya el paradigma del útero estéril. Si es estéril en el útero, la inoculación inicial de microbios depende del proceso del parto y la exposición ambiental subsiguiente (Fig. 1A) y la primera exposición microbiana importante para un bebé nacido por vía vaginal ocurre en el canal del parto. Este paso se pasa por alto durante las cesáreas y, por lo tanto, el modo de parto (parto vaginal versus cesárea) influiría mucho en la composición microbiana [100,101,102,103,104,105,106]. Por el contrario, si un subconjunto del microbioma temprano se adquirió en el útero, entonces las poblaciones bacterianas deberían estar presentes en el intestino del bebé que se superponen con las que se encuentran en la placenta / meconio, y su presencia debería ser independiente del método de liberación. Algunos estudios informan que el meconio contiene bacterias similares a las que se encuentran en el líquido amniótico [10], y los autores han propuesto que la colonización del intestino fetal podría ocurrir a través de la ingestión de líquido amniótico que contiene bacterias [8, 98, 107]. Sin embargo, la gran mayoría de la literatura demuestra que el microbioma intestinal pionero está fuertemente influenciado por el método de nacimiento y luego dominado por especies que son microbios intestinales característicos, mientras que los microbios detectados en el ambiente fetal están ausentes (Fig. 3). Varios estudios han informado diferencias significativas en la diversidad y composición entre los bebés nacidos por vía vaginal versus los nacidos por cesárea [101, 105, 106, 108], y los bebés nacidos por vía vaginal albergan un microbioma temprano que se asemeja al de la vagina, mientras que los microbiomas de C Los lactantes de sección reflejan los de la piel humana [101, 109]. Domínguez-Bello y sus colegas demostraron que las comunidades bacterianas de los recién nacidos con parto vaginal estaban dominadas por Lactobacillus, Prevotella, o Sneathia especies, todas las cuales también se encontraron en la vagina de la madre [101]. En contraste, la microbiota intestinal de los bebés nacidos por cesárea estuvo dominada por los comensales de la piel. Estafilococo, Corynebacterium, y Propionibacterium [101]. Bäckhed y sus colegas también informaron que los microbiomas intestinales de los bebés nacidos por cesárea estaban dominados por microbios cutáneos y orales, así como por bacterias del entorno circundante, mientras que los microbiomas intestinales de los bebés nacidos por vía vaginal estaban enriquecidos en microbios intestinales clásicos (Bacteroides, Bifidobacteria, Parabacteroides, y Escherichia/Shigella) [105]. Los autores establecieron además que el 72% de los primeros colonizadores de recién nacidos con parto vaginal se remonta a la microbiota intestinal de su propia madre, mientras que este número era solo del 41% para los bebés por cesárea. Juntos, estos estudios muestran de manera convincente que el método de administración afecta fuertemente la composición del microbioma en los recién nacidos, mientras que no se han informado taxones microbianos independientes del método de administración que se originan en la placenta / líquido amniótico. Estos hallazgos apoyan el concepto de un intestino infantil estéril que está colonizado por microbios adquiridos durante y después del nacimiento, dependiendo de la exposición ambiental.

D. Consideraciones sobre la derivación de mamíferos libres de gérmenes

La evidencia más sólida contra la existencia de microbiomas en el entorno fetal proviene de la ciencia de la gnotobiología. La gnotobiología es el estudio de animales criados y mantenidos en un entorno en el que todos los microorganismos están definidos o excluidos [110]. La ciencia de la gnotobiología se basa en nuestra capacidad para obtener animales libres de gérmenes mediante cesáreas y, posteriormente, criar a la descendencia en un entorno estéril.

Los primeros animales axénicos se registraron ya a finales del siglo XIX [111], pero se necesitaron hasta la década de 1940 para obtener de forma coherente con éxito roedores axénicos y mantenerlos durante generaciones sucesivas [112,113,114]. Los primeros progenitores libres de gérmenes se generaron mediante el proceso intensivo de mano de obra de cesárea y alimentación manual con una dieta artificial esterilizada dentro de un aislador aséptico hasta la madurez, después de lo cual se estableció una colonia de reproducción [114]. Desde entonces, se ha obtenido con éxito una amplia variedad de animales libres de gérmenes durante los últimos 70 años, incluidos ratones, ratas, cobayas, conejos, perros, gatos, cerdos, corderos, terneros, cabras, babuinos, chimpancés y titíes [ 115,116,117,118,119,120,121,122], lo que demuestra que la capacidad de obtener animales libres de gérmenes no es exclusiva de las especies de roedores. Actualmente, tanto las empresas comerciales como las instalaciones de animales de la universidad ofrecen de forma rutinaria la derivación como un servicio a la comunidad investigadora. La descendencia libre de gérmenes se puede generar a partir de un stock no libre de gérmenes mediante transferencia de embriones e histerectomía aséptica (Fig. 4) e histerotomía aséptica. Para realizar la histerectomía en ratones, las hembras donantes se sacrifican cuando el parto es inminente y el útero gestante intacto se recolecta asépticamente, se pinza, se introduce en un baño germicida y finalmente se transfiere a un aislador estéril. Después de la extracción del útero, las crías se calientan, se secan para estimular su respiración y luego se colocan bajo el cuidado de una madre adoptiva axénica [123,124,125]. La histerotomía generalmente se realiza para generar grandes animales axénicos con la intención de mantener el potencial de reproducción de la hembra. En este escenario, se coloca un dosel estéril con guantes en el abdomen de la madre antes de la cirugía. Con guantes estériles, el cirujano hace una incisión en el útero y extrae la placenta y el saco amniótico, que luego se transfieren a un segundo aislador estéril para que el feto o los fetos puedan revivir en un ambiente aséptico [116, 119].

Representación esquemática de la generación de roedores axénicos mediante histerectomía aséptica. En los roedores, la descendencia libre de gérmenes se obtiene mediante histerectomía aséptica. Las madres adoptivas libres de gérmenes alojadas en un aislador estéril se aparean en el tiempo para quedar embarazadas en sincronía con las hembras holoxénicas (convencionales). Las parejas reproductoras se aparean en un horario tal que la histerectomía aséptica de la madre donante se puede realizar unas horas antes de su cría programada y unas horas después de que la madre adoptiva dé a luz. Para realizar la histerectomía, las hembras donantes se sacrifican y el útero se extrae y se pinza, se introduce asépticamente en un baño germicida y luego se transfiere al aislador estéril donde residen las madres adoptivas. A continuación, los cachorros son revividos y puestos bajo el cuidado de la madre adoptiva [123,124,125]. Si no hay madres adoptivas libres de gérmenes disponibles, los cachorros se crían a mano con fórmula estéril. Figura adaptada de Hedrich y Hardy [125]

Durante las histerotomías e histerectomías, el útero gestante intacto o todo su contenido (incluida la placenta, el saco amniótico y el feto), respectivamente, se extraen y transfieren para generar animales libres de gérmenes. El éxito de estos procedimientos proporciona una clara evidencia contra la existencia de un microbioma en la placenta y el feto. Si los microbios estuvieran presentes, incluso en baja abundancia, colonizarían la descendencia y crecerían rápidamente hasta niveles detectables. Este fenómeno se puede observar durante las contaminaciones accidentales que ocurren (para gran consternación de los investigadores) en instalaciones animales libres de gérmenes. El proceso de derivación puede implicar el tratamiento de la mujer donante no libre de gérmenes con antibióticos para reducir su carga microbiana antes de la histerectomía [125]. Sin embargo, no se aplica la administración oral de agentes antimicrobianos directamente a la descendencia, ni esta práctica lograría generar descendencia axénica a partir de animales que ya están colonizados. El hecho de que los animales axénicos puedan derivarse y mantenerse desprovistos de microbios en condiciones estériles proporciona una evidencia muy convincente de que, en la mayoría de las especies de mamíferos, no se produce la transferencia del microbioma en el útero.

Los partidarios de la hipótesis de la transmisión en el útero a menudo argumentan que las bacterias presentes en el entorno fetal no colonizarían potencialmente un huésped libre de gérmenes o permanecerían indetectables después del nacimiento. Sin embargo, este fenómeno es poco probable. Casi cualquier bacteria coloniza rápida e irreversiblemente ratones libres de gérmenes porque no hay competencia. Otros también argumentan que los animales no son humanos y que los microbiomas fetales pueden ser exclusivos de los humanos debido a diferencias fisiológicas y anatómicas. Sin embargo, se han establecido seres humanos libres de gérmenes (aunque raros) utilizando protocolos similares a los empleados durante la generación de grandes mamíferos axénicos mediante histerotomía aséptica [125,126,127]. Este procedimiento se ha aplicado en casos sospechosos de inmunodeficiencia grave del feto [128]. El primer ser humano libre de gérmenes nació realizando una cesárea dentro de un dosel estéril adherido al abdomen de la madre, lo que evitó la exposición a contaminantes ambientales [126]. Las tinciones de Gram de las heces y los cultivos aeróbicos y anaeróbicos de hisopos tanto del lactante como de las superficies aislantes confirmaron el estado libre de gérmenes del lactante [126, 129, 130]. Los casos publicados informan sobre el estado axénico de 6 días a 3 meses, después de lo cual los sujetos fueron retirados de los aisladores axénicos o se detectó contaminación microbiana [126, 127, 129, 131]. Aunque los humanos axénicos son muy raros por razones obvias, el hecho de que se hayan generado hace que sea extremadamente improbable que los humanos estén colonizados con bacterias en el útero.


Disponibilidad de datos y materiales

Los datos de metagenómica sin procesar están disponibles en ENA (consulte el archivo adicional 2: Tabla S1 para los identificadores de los conjuntos de datos incluidos). Todos los perfiles taxonómicos y funcionales utilizados como entrada para los análisis presentados están disponibles en un repositorio de Zenodo (ver https://doi.org/10.5281/zenodo.4454489 [110]), y el código para reproducir el análisis se puede encontrar en el repositorio de GitHub dedicado (https://github.com/zellerlab/siamcat_paper [111]).

El código fuente de SIAMCAT y el código para reproducir el análisis presentado en este documento están disponibles en Zenodo (ver https://doi.org/10.5281/zenodo.4457522 [113]) bajo la licencia GPL-3.


El humano-Helicobacter pylori asociación: un estudio de caso en tonos de gris

Nuestra visión de las interacciones huésped-microbio ha evolucionado históricamente en el contexto de lo que se ha denominado un "marco dualista" de "bien" versus "mal" [123]. Brevemente, estos incluyen el concepto inicial de patógenos versus huésped, ideas subsecuentes de miembros "buenos" y "malos" de la microbiota y estados inflamatorios y no inflamatorios en el huésped. Sin embargo, como ha sugerido Eberl [123], tanto los microbios como su anfitrión exhiben múltiples fenotipos en una variedad de contextos, y los resultados abarcan un continuo, en lugar de dos categorías distintas que no se superponen. Sugerimos que el caso de Helicobacter pylori, un miembro antiguo [124] y prominente de la microbiota del estómago humano [125, 126] apoya enormemente este punto de vista. Un análisis reciente de datos históricos de pacientes indica que infecta a más de la mitad de la población humana [127] sin embargo, la mayoría de H. pylori los portadores son asintomáticos. Los individuos infectados presentan grados variables de inflamación gástrica y una minoría de hospedadores que disminuye progresivamente desarrolla úlceras pépticas / duodenales o cáncer gástrico o linfoma de tejido linfoide asociado a mucosas.

La coexistencia de H. pylori con su huésped humano, la cronicidad de su infección y la naturaleza variable de los resultados clínicos para el huésped indican que la coevolución de H. pylori y humanos es un proceso continuo y quizás refleja una "forma de transición" de evolución holobionte a la que se alude en la introducción. Se ha sugerido que la opinión de H. pylori como patógeno humano se debe a su descubrimiento en un contexto patogénico y que esta asociación puede verse como el resultado de una compensación entre costos y beneficios para el holobionte humano [128]. De hecho, hay indicios de que H. pylori tiene un efecto protector contra las enfermedades diarreicas infantiles [129]. Inflamación gástrica causada por H. pylori La infección aumenta la respuesta inmunitaria gástrica contra la vacuna contra el cólera [130]. H. pylori la infección también se correlaciona positivamente con una mayor protección contra la tuberculosis [131, 132]. Por lo tanto, es posible que el costo de desarrollar enfermedades más adelante en la vida debido a H. pylori la infección se ve compensada en términos evolutivos por el aumento de la probabilidad de que el huésped humano alcance la edad reproductiva [133].

El espectro de resultados clínicos sobre H. pylori infección, especialmente el desarrollo de cáncer gástrico debido a inflamación crónica más adelante en la vida está fuertemente correlacionada con la presencia de una isla de patogenicidad (PAI) designada cag (gen asociado a citotoxina) que codifica un sistema de secreción de tipo IV (T4SS) y probablemente ha sido adquirido por algunas cepas a través de HGT [134, 135]. los cagPAI codifica la proteína CagA oncogénica que puede translocarse a través de T4SS en células huésped con las que H. pylori entra en estrecho contacto. Esto tiene el efecto de inclinar la balanza a favor de un aumento de la inflamación y del riesgo de cáncer gástrico, pero no se sabe si la inflamación aumentada y crónica debido a H. pylori la infección influye en la HGT en H. pylori y / u otros miembros de la microbiota humana. Un subconjunto de H. pylori Las cepas también codifican una o más T4SS que pueden transferir ADN a otras cepas, así como a especies relacionadas como Campylobacter jejuni in vitro [136]. Dado que los hábitats primarios de estas dos bacterias son diferentes:H. pylori habitando el estómago y C. jejuni el intestino delgado: esto plantea la posibilidad de HGT entre las especies bacterianas residentes y en tránsito, lo que garantiza la diseminación de genes de un nicho ecológico a otro. Rohrer y col. determinó que el peine T4SS (presente en todos H. pylori cepas) era necesaria para la captación de plásmido en el receptor H. pylori células tanto por transformación como por conjugación [137]. Los genomas de algunos H. pylori Las cepas contienen "zonas de plasticidad" que albergan transposones que codifican, entre otros elementos, la tfs3 [138, 139] y tfs4 [140] sistemas de secreción de tipo IV. Sin embargo, los componentes de estos dos T4SS no parecen influir en la HGT [137].

Tiempo H. pylori es naturalmente competente [141, 142], también codifica un número excepcional de enzimas R-M, más de veinte en promedio en todas las cepas conocidas (ver https://tinyurl.com/y9pntzw3). Presenta una considerable diversidad de cepas a través de ubicaciones geográficas [143] e incluso dentro de un único huésped humano [144]. Dado el gran número de enzimas R-M que codifica cada cepa, se esperaría que la HGT de especies trans involucre preferentemente H. pylori en el papel de donante de ADN, en lugar de un aceptador, como se vio en el caso de C. jejuni (encima). Incluso entre H. pylori cepas, podríamos esperar que el éxito de HGT podría depender del grado de parentesco genético (es decir, compartir el mismo complemento R-M). Por cierto, los experimentos de transferencia de plásmidos de Rohrer et al. [137] que involucra aislados clínicos no relacionados de H. pylori sugieren que los numerosos sistemas R-M no son barreras insuperables para la transferencia de ADN en H. pylori. Bubendorfer y col. (2016) llevaron a cabo un análisis detallado de la transferencia entre cepas de fragmentos de ADN genómico y sus patrones de integración en el genoma receptor mediante recombinación homóloga utilizando H. pylori cepas en un intento de abordar este problema [145]. Su estudio, realizado íntegramente in vitro, indicó que los sistemas receptores R-M no parecen afectar la integración del ADN homólogo, aunque parecen ser barreras efectivas contra la integración del ADN heterólogo.


Información del autor

Mathieu Groussin y Florent Mazel: estos autores contribuyeron igualmente a este trabajo

Afiliaciones

Centro de Informática y Terapéutica del Microbioma, Instituto de Tecnología de Massachusetts, Cambridge, 02139, Massachusetts, EE. UU.

Mathieu Groussin, Chris S. Smillie y Eric J. Alm

Departamento de Ingeniería Biológica, Instituto de Tecnología de Massachusetts, Cambridge, 02139, Massachusetts, EE. UU.

Mathieu Groussin, Chris S. Smillie y Eric J. Alm

Laboratoire d Ecologie Alpine, CNRS, Universidad de Grenoble Alpes, FR-38041, Grenoble, Cedex 9, Francia

Florent Mazel, Sébastien Lavergne y Wilfried Thuiller

Biología Organísmica y Evolutiva, Universidad de Harvard, 26 Oxford St, Cambridge, 02138, Massachusetts, EE. UU.

The Broad Institute of MIT y Harvard, 415 Main Street, Cambridge, 02142, Massachusetts, EE. UU.


¿Cómo se adquiere el microbioma intestinal estratificado apropiadamente en organismos que realizan transmisión horizontal? - biología

En muchos casos, las interacciones entre el hospedador, el patógeno y el medio ambiente son insuficientes para describir la dinámica de la enfermedad en la naturaleza.

El microbioma del huésped juega un papel importante en la inmunidad del huésped, en la interfaz entre el huésped y el patógeno, y afecta el resultado de la enfermedad.

El medio ambiente, así como los microbiomas ambientales, influyen en el microbioma del huésped y también influyen simultáneamente en el huésped y el patógeno.

El triángulo de enfermedades de tres bordes debe convertirse en una pirámide de enfermedades de cuatro bordes para estudiar las interacciones entre el huésped, el microbioma del huésped, el patógeno y el medio ambiente.

Los microorganismos se reconocen cada vez más como componentes relevantes para el ecosistema porque afectan la dinámica de la población de los huéspedes. Al funcionar en la interfaz del huésped y el patógeno, los microbiomas de la piel y el intestino son componentes vitales de la inmunidad. Un trabajo reciente revela una fuerte influencia de los factores ambientales bióticos y abióticos (incluido el microbioma ambiental) en la dinámica de la enfermedad, sin embargo, la importancia de la interacción huésped-microbioma huésped-patógeno-ambiente se ha reflejado pobremente en la teoría. Usamos anfibios y la enfermedad quitridiomicosis causada por el patógeno fúngico. Batrachochytrium dendrobatidis para mostrar cómo las interacciones entre el huésped, el microbioma del huésped, el patógeno y el medio ambiente afectan el resultado de la enfermedad. Nuestra revisión proporciona nuevas perspectivas que mejoran nuestra comprensión de la dinámica y la ecología de las enfermedades al incorporar factores ambientales y microbiomas en la teoría de las enfermedades.