Información

¿Qué hace que una señal de poliadenilación fuerte sea una señal fuerte?

¿Qué hace que una señal de poliadenilación fuerte sea una señal fuerte?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Me preguntaba por qué "AAUAAA" es una fuerte señal de poliadenilación mientras que el resto de las señales de poliadenilación muestran una reducción de la escisión y eficacia de poliadenilación.


Simplemente ampliando el comentario de aandreev.


La poliadenilación se inicia mediante la unión de CPSF (factor de especificidad de escisión y poliadenilación) después de su unión alAAUAAAmotivo.
De la introducción de este artículo:

CPSF (factor de especificidad de escisión y poliadenilación) se une al hexámero AAUAAA a través de su subunidad de 160 kDa y posiblemente su subunidad de 30 kDa (Keller et al., 1991; Murthy y Manley, 1992; Jenny et al., 1994; Barabino et al. , 1997). CstF (factor de estimulación de escisión) se une al elemento rico en U o G / U corriente abajo del sitio de escisión y estabiliza la unión de CPSF a la secuencia AAUAAA del pre-mRNA (revisado en Colgan y Manley, 1997; Wahle y Kuhn, 1997).

Cualquier alteración en el sitio de unión de CPSF conducirá a una eficiencia de poliadenilación reducida. La eficacia de la poliadenilación también depende de otros factores como la estructura secundaria y la presencia de sitios CstF proximales.


Una señal de poliadenilación interna aumenta sustancialmente los niveles de expresión de los transgenes suministrados por lentivirus, pero tiene el potencial de reducir el título viral de una manera dependiente del promotor.

En los sistemas de administración de genes lentivirales, los casetes de expresión transgénica se clonan comúnmente sin una señal de poliadenilación para evitar la interrupción de los genomas lentivirales de longitud completa en la maduración del ARNm en las células productoras. Sin embargo, la falta de la señal de poliadenilación tiene el potencial de reducir la estabilidad y la eficiencia de traducción del ARNm del transgén. Por lo tanto, hemos evaluado el efecto de una fuerte señal de poliadenilación interna [poli (A)] tanto en los niveles de expresión del transgén en las células infectadas por virus como en el título viral funcional, en una serie de ocho lentivirus autoactivantes que expresan el transgén mOrange bajo el control del citomegalovirus constitutivo (CMV), del factor de elongación 1 alfa (EF1 alfa) y de los promotores beta-actina o del promotor del híbrido antígeno prostático / probasina altamente específico específico de tejido (PSA / Pb) con o sin un virus de simio 40 (SV40) temprano señal de poliadenilación cadena abajo de la secuencia codificante de mOrange. Mostramos que los niveles de expresión de mOrange en HEK-293, LNCaP y células epiteliales de próstata primarias infectadas con virus aumentaron de 3 a 6,5 ​​veces cuando estaba presente una señal de poliadenilación interna. Cuando se usaron los promotores CMV y EF1alpha, el título viral funcional disminuyó de 8 a 9 veces en presencia de la señal de poliadenilación, pero el título no se vio afectado cuando la expresión del transgén fue impulsada por el promotor beta-actina o el PSA / Pb específico de tejido. promotor. Por tanto, llegamos a la conclusión de que una señal de poliadenilación interna en vectores lentivirales tiene un efecto muy beneficioso sobre la expresión transgénica, pero reduce el título viral de una manera dependiente del promotor.


Fondo

Los vectores virales son herramientas eficientes para expresar transgenes en diversos tipos de células. in vitro y en vivo. El tipo de virus debe seleccionarse con cuidado, ya que presenta ventajas y desventajas, según el propósito de la investigación [1]. Se sabe que el virus adenoasociado (AAV) es uno de los vectores virales más útiles para la liberación de transgenes porque no es patógeno, induce una respuesta inmune mínima, infecta tanto a las células en división como a las que no se dividen y la expresión del transgén persiste durante más tiempo. tiempo en las celdas. Los genomas de los vectores AAV infectados en la célula huésped existen principalmente en un estado extracromosómico, sin integrarse en el genoma del huésped. Pueden insertarse en un solo sitio de integración específico en el genoma humano, lo que puede ser una ventaja para la expresión estable a largo plazo sin mutagénesis de inserción. Además, AAV se puede producir fácilmente en títulos altos y entregar transgenes con alta eficiencia. Adenovirus, virus del herpes simple (HSV), retrovirus y lentivirus también tienen sus ventajas en la entrega de transgenes. Sin embargo, el adenovirus y el HSV no son adecuados para la expresión estable en células que no se dividen, como las neuronas, porque solo permiten una expresión transitoria. También tienen la desventaja de inducir altas respuestas inmunes. Los retrovirus solo transducen células en división y, al igual que los lentivirus, tienen riesgo de mutagénesis por inserción [1]. Por estas razones, los vectores AAV se utilizan con frecuencia en investigaciones básicas y son candidatos atractivos para su uso en terapia génica. El VAA también ha sido el vector de elección en ensayos clínicos recientes de enfermedades neurológicas, incluidas la enfermedad de Parkinson y Alzheimer [2].

Sin embargo, el uso de vectores AAV está limitado por su capacidad máxima de empaquetamiento relativamente pequeña [3, 4]. Aunque hay un informe que describe serotipos específicos con una capacidad de empaquetamiento mucho mayor [5], otros estudios [6-8] indicaron que los genomas intactos no estaban, de hecho, empaquetados en ese caso [3], y sugirieron además un límite de tamaño estricto de 5,2 kb. Se han realizado esfuerzos para expandir el tamaño del transgén de AAV disponible mediante empalme en trans y / o recombinación para dividir el casete de expresión de AAV en dos vectores virales [9]. Sin embargo, la eficacia de expresión sigue siendo mucho menor que la de un solo vector viral.

A pesar de estos esfuerzos, todavía no se encuentra disponible un casete de expresión de AAV capaz de administrar un transgén grande con un alto nivel de expresión. Como estrategia para expandir el tamaño disponible de transgenes en AAV, decidimos minimizar el tamaño del casete de expresión para permitir más espacio para los transgenes. Usando un casete de expresión de AAV conocido por expresar transgenes con alta eficiencia como plantilla, generamos una variedad de casetes más cortos. Luego evaluamos sistemáticamente su eficiencia de expresión en neuronas para maximizar la capacidad de empaquetamiento sin comprometer la expresión transgénica.


Resultados

Desarrollo de un sistema indicador de luciferasa para evaluar la eficacia de la poliadenilación

Para probar si los sitios de poliadenilación específicos de células germinales masculinas estaban poliadenilados de manera ineficaz en células somáticas, desarrollamos un sistema para analizar la eficacia de poliadenilación. Usamos PCR para aislar secuencias genómicas que rodean varios sitios de poliadenilación usados ​​in vivo a estas secuencias las llamamos casetes de poliadenilación (los cebadores usados ​​para fabricar estos casetes se muestran en la Tabla 1). Cada casete de poliadenilación tenía entre 150 y 200 pares de bases de largo, aproximadamente centrado en el sitio de poliadenilación. Cada casete de poliadenilación se subclonó por separado aguas abajo de la región codificante de luciferasa de Renilla (en sustitución del casete tardío de SV40 que forma parte del indicador) para producir un plásmido indicador. Este plásmido indicador se cotransfectó luego en células somáticas (fibroblastos embrionarios de ratón) con un plásmido separado que expresa luciferasa de luciérnaga para controlar la eficacia de la transfección (ver Materiales y métodos). Dado que la poliadenilación eficaz es necesaria para la expresión génica [6-8, 33], la actividad luciferasa relativa (el cociente de las actividades luciferasa de Renilla y luciérnaga) se utilizó como una medida de la eficacia de poliadenilación para cada casete de poliadenilación. Se han desarrollado sistemas de ensayo similares utilizando el sistema informador CAT [34, 35].

Para determinar si nuestro ensayo mide la eficacia de la poliadenilación, probamos tres casetes de poliadenilación previamente caracterizados. Los dos primeros, los casetes de poliadenilación de β-globina tardía de SV40 y de conejo, son casetes de poliadenilación fuertes y, por lo tanto, se utilizaron como referencia para una poliadenilación eficaz. El tercero fue un casete mutante tardío de SV40, que fue el resultado de la mutación de la señal poli (A) de AAUAAA a GAGAAA. La mutación del AAUAAA de SV40 se demostró previamente para prevenir la unión de la maquinaria de poliadenilación al pre-mRNA, evitando así la elección del sitio de poliadenilación y dando como resultado una poliadenilación ineficaz [5, 36, 37].

Transfectamos células de fibroblastos embrionarios de ratón (ATCC-3T3) con los plásmidos informadores anteriores y 48 horas más tarde lisamos las células y ensayamos los lisados ​​para determinar la actividad luciferasa. Se realizaron experimentos piloto para determinar las condiciones de transfección que produjeron un aumento lineal en la actividad de luciferasa de Renilla (datos no mostrados). Como se esperaba, los lisados ​​de células transfectadas con plásmidos informadores que contienen los casetes de poliadenilación de β-globina de conejo o tardío de SV40 de tipo salvaje mostraron niveles significativamente más altos de luciferasa que los lisados ​​de células transfectadas con el plásmido informador que contiene mutante (Figura 1). Curiosamente, los lisados ​​de células transfectadas con plásmidos informadores que contienen el casete de poliadenilación tardía de SV40 mostraron niveles 3,5 veces más altos de actividad luciferasa que los que contienen el casete de β-globina de conejo (Figura 1). Esto podría deberse a que el casete de poliadenilación tardía de SV40 es viral y, por lo tanto, altamente eficaz en muchos tejidos, mientras que el casete de β-globina de conejo se expresa en fibroblastos de ratón en lugar de reticulocitos de conejo (donde se expresa normalmente). Estos datos demuestran que la actividad luciferasa en los lisados ​​de estas células se correlaciona con la eficacia de la poliadenilación.

El ensayo de luciferasa evalúa la eficacia de la poliadenilación. Se transfectaron células ATCC 3T3 (fibroblastos embrionarios de ratón) con Renilla plásmidos informadores de luciferasa que contienen uno de los casetes de poliadenilación indicados (abajo) así como un vector que expresa luciferasa de luciérnaga para controlar la eficacia de la transfección. Dos días después, se ensayaron extractos de estas células para determinar la actividad luciferasa. A la izquierda se indica la actividad luciferasa relativa (Renilla valores de luciferasa divididos por valores de luciferasa de luciérnaga). Los asteriscos indican una diferencia significativa con respecto al tipo salvaje SV40 según lo determinado por la prueba T de Student (p & lt 0,01).

Para probar si un casete de poliadenilación específico de células germinales masculinas podría poliadenilarse eficazmente en células somáticas, se creó otro plásmido indicador con el casete de poliadenilación a partir del pre-ARNm de zonadhesina. Dado que el ARNm de zonadhesina se expresa sólo en células germinales masculinas [38], se utilizó como referencia para la poliadenilación específica de células germinales masculinas. De manera similar a los resultados con el plásmido informador mutante SV40, el nivel de actividad luciferasa en lisados ​​de células transfectadas con el plásmido informador que contiene el casete de zonadhesina fue significativamente menor que el nivel en lisados ​​de células transfectadas con el plásmido informador que contiene SV40 (Figura 1 ). Por lo tanto, la actividad luciferasa presente en lisados ​​de células transfectadas con un plásmido indicador que contiene un casete de poliadenilación específico de células germinales masculinas fue similar al nivel encontrado en lisados ​​de células transfectadas con un casete poliadenilado ineficazmente.

Los genes con sitios de poliadenilación específicos de células germinales masculinas se expresan en niveles más bajos que aquellos con sitios de poliadenilación somáticos del mismo ARNm

Los casetes de poliadenilación de β-globina de conejo y de tipo salvaje de SV40 están bien caracterizados [1, 2]. Para determinar si los sitios de poliadenilación específicos de células germinales masculinas son realmente ineficazmente poliadenilados en relación con los sitios de poliadenilación somáticos en células somáticas, comparamos la eficacia de poliadenilación de casetes específicos de células germinales masculinas y somáticas que derivan del mismo gen. Dado que la ciclina A2 potencialmente puede usar dos sitios de poliadenilación diferentes en las células somáticas y dos sitios de poliadenilación diferentes en las células germinales masculinas [30], se transfectaron fibroblastos embrionarios de ratón con plásmidos informadores que contenían casetes de poliadenilación específicos de células germinales somáticas o masculinas de la ciclina ARNm de A2. A continuación, se ensayó la actividad luciferasa de los lisados ​​de estas células transfectadas. Como se muestra en la Figura 2A, los lisados ​​de las células transfectadas con los plásmidos informadores que contienen los casetes de poliadenilación somático-1 y somático-2 de la ciclina A2 mostraron una actividad luciferasa mucho mayor que los lisados ​​de las células transfectadas con el germen masculino específico de la célula-1 y el germen masculino plásmidos que contienen casete de poliadenilación 2 específico de célula. Por lo tanto, para el pre-ARNm de ciclina A2, la transfección de células con plásmidos informadores que contienen los casetes de poliadenilación somática dio como resultado la expresión de niveles más altos de actividad luciferasa que los que contienen los casetes de poliadenilación específicos de células germinales masculinas.

Los casetes de poliadenilación somática se prefieren a los casetes específicos de células germinales.. A) En la parte superior hay un mapa que indica las posiciones de los diversos sitios de poliadenilación en el ARNm de ciclina A2. Encima del diagrama están las posiciones de los sitios poli (A) utilizados [27], y debajo está el nombre del casete. El diagrama está dibujado aproximadamente a escala. A continuación, las células ATCC 3T3 (fibroblastos embrionarios de ratón) se transfectaron con plásmidos que contenían los casetes específicos de células germinales masculinas o somáticas indicados y los extractos se analizaron para determinar su actividad como se describe en la Figura 1. B) Igual que A, pero usando CREM y c-abl casetes. Las posiciones de poli (A) en la parte superior son de [26, 28]. Tanto para A como para B, los asteriscos indican una diferencia significativa del casete somático respectivo según lo determinado por la prueba T de Student (p & lt 0,01).

Estos estudios se ampliaron para comparar las eficiencias de poliadenilación de los distintos CREM y c-abl Casetes de poliadenilación, cada uno de los cuales utiliza un sitio de poliadenilación en las células somáticas y un sitio diferente en las células germinales masculinas [29, 31]. Transfectamos fibroblastos con plásmidos informadores que contenían casetes de poliadenilación de c-abl y ARNm de CREM. De nuevo, los lisados ​​de células transfectadas con plásmidos informadores que contienen casetes de poliadenilación específicos de células germinales masculinas mostraron niveles más bajos de actividad luciferasa que los lisados ​​con casetes somáticos en los plásmidos indicadores (Figura 2B). Por tanto, incluso cuando se estudian independientemente unos de otros, los sitios de poliadenilación somáticos están asociados con niveles más altos de actividades de luciferasa en extractos de células transfectadas.

Los sitios de poliadenilación específicos de células germinales masculinas se utilizan de manera ineficaz en células somáticas

Queríamos determinar si los bajos niveles de actividad luciferasa que observamos en extractos de células transfectadas con plásmidos informadores que contienen casetes de poliadenilación específicos de células germinales masculinas se debían a problemas con la elección del sitio de poliadenilación. Para hacer esto, transfectamos fibroblastos embrionarios de ratón con plásmidos informadores usados ​​en experimentos anteriores, extrajimos ARN de las células transfectadas, producimos ADNc y lo sometimos a 3 'RACE. Los productos se purificaron, clonaron y secuenciaron, y las secuencias se alinearon con el plásmido indicador con el que se transfectaron estas células para determinar el sitio de poliadenilación (ver Métodos y materiales).

La figura 3 resume los resultados de estos experimentos. De los siete ADNc que clonamos a partir de células transfectadas con plásmidos informadores que contienen el casete de poliadenilación tardía de SV40, cinco se poliadenilaron en el sitio informado y los otros dos estaban dentro de las 100 bases del sitio informado. De manera similar, cinco de los cinco ADNc clonados a partir de células transfectadas con plásmidos informados que contienen el casete de β-globina de conejo se poliadenilaron en el sitio de poliadenilación informado.

Los sitios de poliadenilación específicos de células germinales masculinas no se utilizan en células somáticas. Se transfectaron células ATCC 3T3 (fibroblastos embrionarios de ratón) con plásmidos informadores que contenían los casetes de poliadenilación indicados a la izquierda y dos días después se extrajo el ARN de estas células, se fabricó ADNc y se realizó 3 'RACE como se describe en Métodos y materiales. Se muestran los resultados de la identificación del sitio poli (A). La flecha abierta en la parte inferior indica el sitio informado de poliadenilación en ese casete de poliadenilación. Las flechas negras en la parte superior representan los sitios de poliadenilación identificados en las células transfectadas. La barra negra en el mutante SV40 muestra una mutación en la señal poli (A) (AAUAAA a GAGAAA) del casete de poliadenilación de SV40.

Por el contrario, los cinco ADNc clonados de células transfectadas con el plásmido informador que contiene el casete de poliadenilación mutante tardío SV40 mostraron poliadenilación en posiciones aberrantes, corriente arriba, y nunca en el sitio informado de poliadenilación (Figura 3). Esta poliadenilación aguas arriba es diferente de la lectura a través de las transcripciones que la mayoría de los investigadores han observado debido a la poliadenilación ineficaz [39-41]. Además, los ADNc clonados de células transfectadas con plásmidos informadores que contienen casetes de poliadenilación específicos de células germinales masculinas mostraron poliadenilación aguas arriba aberrante, similar a la observada con el mutante SV40. Curiosamente, la mayoría de los sitios de poliadenilación aberrantes se encontraron en la región codificante de luciferasa. Por lo tanto, todos los casetes de poliadenilación asociados con niveles bajos de luciferasa dan lugar a ARNm poliadenilados aberrantemente cuando se transfectan en células somáticas.

Las secuencias en los casetes afectan la eficiencia de la poliadenilación

CisSe ha demostrado que las secuencias que actúan alrededor del sitio de poliadenilación afectan profundamente la eficacia de la poliadenilación [3-9]. Planteamos la hipótesis de que la razón por la que los sitios de poliadenilación específicos de células germinales masculinas no se eligieron en las células somáticas fue porque carecían de los cis-secuencias de acción que requiere la elección del sitio de poliadenilación somática. Si esto fuera cierto, alterar las secuencias en un casete de poliadenilación específico de células germinales masculinas aumentaría la capacidad de un sitio de poliadenilación específico de células germinales masculinas para ser elegido en células somáticas.

Para probar esta hipótesis, creamos cuatro casetes de poliadenilación. Tres de ellos (SV40 de tipo salvaje tardío, SV40 mutante tardío y zonadhesina) se utilizaron en estudios anteriores. También creamos un mutante de zonadhesina, que convirtió una señal GAGAAA putativa de poli (A) específica de células germinales masculinas en una AAUAAA. Las células se transfectaron con plásmidos informadores que contenían cada uno de estos cuatro casetes de poliadenilación y, posteriormente, se ensayó la actividad luciferasa de los lisados. Como antes, las células transfectadas con el plásmido informador que contiene SV40 tardío mostraron niveles altos de actividad luciferasa relativa, y los lisados ​​de células transfectadas con plásmidos informadores que contienen zonadhesina y mutante tardío de SV40 mostraron niveles significativamente más bajos de actividad relativa (Figura 4). Sin embargo, cuando las células se transfectaron con los plásmidos informadores que contenían un casete de poliadenilación mutante de zonadhesina, se observaron niveles significativamente más altos de actividad luciferasa en comparación con el plásmido informador que contenía zonadhesina. Por lo tanto, alterar la señal de poli (A) en un casete de poliadenilación específico de células germinales masculinas puede aumentar la actividad luciferasa en extractos de células transfectadas con este plásmido.

La señal poli (A) es esencial para la poliadenilación de sitios de poliadenilación específicos de células germinales masculinas.. Se transfectaron células ATCC 3T3 (fibroblastos embrionarios de ratón) con plásmidos informadores que contenían los casetes de poliadenilación indicados.Las barras representan la actividad luciferasa relativa promedio en tres replicaciones diferentes. Los asteriscos indican una diferencia significativa con la versión de tipo salvaje de cada casete (p & lt 0,01).


Funciones APA

Interacción con miARN

Los miARN son un tipo de elemento de acción trans que puede unirse a la 3'UTR del ARNm y regular la expresión génica a nivel postranscripcional [37,38,39,40]. Regulan la traducción y la estabilidad de sus ARNm de unión a través de la inhibición de la traducción y la degradación del ARNm [41, 42]. Debido a la existencia de APA en el 3'UTR, se generan varias isoformas con diferentes terminales 3 '[43]. Este mecanismo puede cambiar los sitios de unión de miARN que contiene la 3'UTR (Fig. 2a yb). Los miARN distintos que se dirigen a 3'UTR-APA se descubrieron por primera vez en células cancerosas y células T activadas. En comparación con las células T no activadas y las células no transformadas, la longitud de 3'UTR en las células T activadas y las células cancerosas se acorta significativamente [44, 45]. Las 3'UTR más cortas solo poseen sitios de unión de miARN proximales en las células germinales de ratón macho, mientras que aquellas con 3'UTR más largas tienden a contener sitios de unión de miARN distales [46]. De manera similar, el análisis en profundidad de las isoformas 3'UTR de IGF2BP1 encontró nueve PAS funcionales en líneas celulares de cáncer de HLF humano. También se ha revelado que muchos de ellos carecen de sitios de unión de miARN en estas isoformas abreviadas [45]. Esto demuestra que se producen diferentes números de sitios de unión de miARN entre estas isoformas 3'UTR y muestra que el uso diferencial de PAS puede ser un indicador clínico de enfermedad humana. Además, la reducción de los sitios de unión de miARN no es la única consecuencia del acortamiento de 3'UTR. También se observa que los sitios de unión de miARN conservados se enriquecen preferentemente corriente arriba de los sitios APA. Se descubrió que el acortamiento de 3'UTR puede mejorar la eficacia de focalización de los miARN que se unen aguas arriba del PAS proximal [47]. Por lo tanto, el acortamiento de la 3'UTR, resultante de APA, afecta no solo al número de sitios de unión de miARN dentro de la 3'UTR, sino también a la eficacia de focalización de los miARN.

Funciones APA. Un diagrama esquemático que ilustra la interacción ARN-RBP y la interacción ARN-miARN. a Múltiples sitios de unión a RBP y sitios de unión a miARN se encuentran en la 3'UTR del ARN. En cuanto a la interacción entre miARN y 3'UTR, el miARN generalmente inhibe y silencia el ARN diana. B El esquema de interacción ARN-miARN. Los miARN se pueden transcribir en primer lugar como transcripciones de miARN primarios largos (pri-miARN) con un casquete 5 'y una cola de 3' poli (A) mediante Pol II. Luego, el pri-miRNA es cortado por Drosha RNase III y se convierte en pre-miRNA en el núcleo. El pre-miARN sale de los núcleos y se procesa en ARN bicatenario de 21 nucleótidos de longitud. Una hebra se combina con proteínas AGO para formar RNP que contienen miARN (miRNP). El complejo miRNP se une al ARNm diana complementario y recluta deadenilasa para reprimir la traducción. C, D Interacciones ARN-RBP. C ELAV conduce a la expresión de isoformas de 3'UTR largas durante la neurogénesis al inhibir el uso de PAS proximal. D TTP recluta el complejo CCR4-NOT en el ARE en el 3'UTR del gen diana y desadenila el ARNm que causa su inestabilidad.

Interacción con la proteína de unión al ARN

La interacción entre el ARN y la proteína es esencial para regular la expresión génica a nivel postranscripcional (Fig. 2c yd). Como clase de proteínas altamente conservadas evolutivamente, la RBP desempeña un papel clave en la regulación génica postranscripcional (PTGR), incluidos los aspectos de maduración, estabilidad, transporte y degradación de los ARN celulares. La mayoría de las RBP se unen al ARNm y al ARN no codificante, de los cuales solo

El 2% son específicos de tejido. Las RBP se expresan ampliamente y generalmente muestran niveles de expresión más altos que los niveles promedio de proteínas celulares [48, 49, 50]. El complejo formado por RBP y ARN, ribonucleoproteína (RNP), es el principal regulador de la PTGR. Los defectos en la función de RBP y el ensamblaje de RNP son factores causales importantes que conducen a diversas enfermedades humanas, incluidos los cánceres. Los tipos de ARN (p. Ej., ARNm, ARN ribosómico y ARNt) que están unidos predominantemente por las RBP conducen a los fenotipos característicos de estas enfermedades relacionadas con las RBP [51,52,53].

Las RBP contienen dominios de unión a ARN (RBD) específicos. Estos proporcionan una selección preferencial de sitios de unión y objetivos e interactúan con el ARN a través de estas regiones de reconocimiento. Estos RBD incluyen el motivo de reconocimiento de ARN (RRM), el dominio de homología K (KH), el motivo DEAD, el motivo de unión a ARN bicatenario (DSRM), el dominio de dedos de zinc en tándem CCCH y la homología p de Pumilio y ARNm de Fem-3 Dominios del factor de unión (PUF) [48, 54, 55, 56]. A través de sus dominios RRM, KH y los dedos de zinc, las RBP reconocen los elementos ricos en adenilato-undilato (ARE), que están incrustados en la 3'UTR y están presentes en el 5-8% de los genes humanos. Estas prácticas comerciales restrictivas se denominan ARE-RBP [57]. Al igual que en los sitios de unión de miARN, el número alterado de motivos de unión de RBP (como ARE o elementos ricos en GU) causados ​​por 3'UTR-APA puede mediar la estabilidad del ARNm. Por ejemplo, la proteína reguladora de ARNm triestraprolina (TTP, también conocida como ZFP36) puede reclutar el complejo CCR4-NOT a los ARE en la 3'UTR del gen diana y luego desadenilar el ARNm, desestabilizándolo. La falta de estos ARE dará como resultado un aumento excepcional en la expresión de ARNm [58, 59, 60]. En cuanto a TTP, la proteína reguladora de empalme de homología K (KSRP) es otra proteína involucrada en la degradación del ARNm. Gherzi y col. mostró que KSRP es un factor esencial para la desintegración del ARNm dirigida por ARE. El agotamiento de KSRP da como resultado la estabilización de varios ARNm que contienen ARE, como TNFα y c-Fos. Esta estabilización se observa en S100 empobrecido en KSRP de varios tipos de células, incluidas las células Jurkat, HeLa y HT1080 [61]. Además, debido a la APA, el factor regulador 5 de IFN humano (IRF5) tiene dos isoformas con diferentes 3'UTR. Los niveles de expresión alternativos de estas dos isoformas pueden causar lupus eritematoso sistémico [62].

Como puede verse en los estudios anteriores, la interacción entre las RBP y la 3'UTR está profundamente involucrada en la PTGR y la estabilidad del ARNm. A menudo es difícil disociar la enfermedad de la transcripción y la traducción. La regulación de la unión de RBP-RNA es un mecanismo patógeno muy importante de la enfermedad. Por ejemplo, la proteína de unión a ARN inducible por frío (CIRP, también conocida como CIRBP o A18 hnRNP) es una proteína inducida por estrés involucrada en el cáncer. CIRP puede unirse a las transcripciones de genes pro-supervivencia, que contienen motivos de firma de ARN en sus 3'UTR, y estabilizarlos. En modelos de xenoinjerto de ratón ectópico de cáncer de mama humano y melanomas, CIRP promueve el crecimiento tumoral al aumentar el nivel de expresión de HIF-1α. El análisis inmunohistoquímico muestra que CIRP se sobreexpresa en el estroma y las áreas hipóxicas de los tumores humanos [63]. Además, el CIRP también puede transferirse desde el núcleo al citoplasma y unirse a la 3'UTR del ARNm de ciclina E1 y el ARNm de hTERT, estabilizándolos y regulando positivamente [64]. Musashi (MSI) es otra proteína de unión de ARN, un mediador de varios procesos biológicos críticos relevantes para la iniciación y progresión del tumor. Se observó que la MSI estaba regulada al alza en muchos tipos de cáncer humano, incluidos los cánceres colorrectal, de pulmón y de páncreas y los glioblastomas. MSI regula la invasión del cáncer y la metástasis mediante la regulación de la estabilidad del ARNm y la traducción de proteínas en varias vías de señalización oncogénicas esenciales, incluidas las de NUMB / Notch, PTEN / mTOR, TGFβ / SMAD3, MYC, cMET y otras [65].

Los RBP y los ARN se ensamblan en un complejo RNP dinámico. Esto juega un papel importante en la maduración, regulación y transporte del ARN. Las mutaciones en los RNP nucleares heterogéneos (hnRNP) causan esclerosis lateral amiotrófica (ELA) [66, 67]. La neurona motora de supervivencia 1 (SMN1) es un componente del complejo de ensamblaje de las pequeñas RNP nucleares (snRNP). Su pérdida de función afecta directamente al espliceosoma y conduce a una atrofia muscular espinal [68]. El ARNm del inhibidor de quinasa dependiente de ciclina 1B (CDKN1B) se desestabiliza por la sinergia de miR-221 y / o miR-222 y las proteínas homólogas de Pumilio (PUM) [69]. En Drosophila melanogaster, la proteína visual anormal embrionaria-letal (ELAV) puede reclutarse en la ARN polimerasa II (Pol II) en regiones promotoras con secuencias GAGA y luego suspender Pol II. ELAV aumenta la expresión de isoformas de 3'UTR largas durante la neurogénesis al inhibir el uso de PAS proximal [70, 71]. Todos estos estudios indican que no solo la expresión de la RBP, sino también el tipo de ARN unido por la RBP, están implicados en la patogénesis de la enfermedad. Estos fenotipos característicos y factores de RBP podrían investigarse como posibles nuevos marcadores para su uso en el diagnóstico y pronóstico de enfermedades.

Impactos en la represión genética y la versatilidad

UR-APA juega un papel importante en la generación de transcripciones truncadas. Por ejemplo, Singh et al. demostraron que las isoformas intrónicas de APA, tan ampliamente expresadas en las células inmunes y como participantes en el desarrollo de las células B, conducen a la producción de proteínas truncadas que carecen de dominios C-terminales funcionales. Además, el número de isoformas intrónicas de APA disminuye en las células de mieloma múltiple. Esto puede contribuir a la progresión de mielomas múltiples y es un factor asociado con una supervivencia libre de progresión más corta [72]. Se ha desarrollado una herramienta de caracterización de exón terminal (TEC) para el análisis de datos de secuenciación de ARN con el fin de identificar isoformas que terminan en sitios intrónicos poli (A) y descubrir la prevalencia de estas isoformas de APA [73]. Se observó una subunidad del factor de estimulación de escisión denominada CSTF3 con PAS intrónicos altamente conservados que podrían conducir a la producción de proteínas severamente truncadas, probablemente no funcionales [74]. Esto también implicó una regulación de retroalimentación negativa para reducir la expresión de CSTF3 ya que un nivel de expresión alto podría inducir la producción de esta isoforma UR-APA. De manera similar, la proteína de unión al retinoblastoma 6 (RBBP6) tiene una isoforma llamada Iso3, que es producida por el APA intrónico de RBBP6. Iso3 está regulado a la baja en varios cánceres humanos y puede competir con la RBBP6 normal por unirse a la maquinaria central, inhibiendo así la poliadenilación y regulando el APA [75]. Las isoformas truncadas de Dicer y Forkhead box N3 (dos proteínas supresoras de tumores) también carecen de capacidad supresora de tumores en los tumores [76]. Estos estudios sugieren que la generación de proteínas truncadas por UR-APA podría representar un mecanismo de inhibición de genes muy extendido.

Por otro lado, la diversificación de proteínas también puede ser una parte clave de la versatilidad genética. Por ejemplo, hay dos isoformas de ARNm de cadena pesada de inmunoglobulina M (IgM). El más largo, con el uso de PAS distal en el extremo 3 del tercer exón, es apropiado para la unión a la membrana, mientras que el más corto, con el PAS proximal en un uso de exón terminal compuesto, está involucrado en la secreción. Los diferentes ARNm también predominan en las diferentes etapas del desarrollo de los inmunocitos, los más largos en las etapas de los linfocitos y el más corto en las etapas de secreción [10]. Otro caso clásico es el del gen del polipéptido α relacionado con la calcitonina (CALCA). CALCA tiene dos isoformas de transcripción. El que usa PAS proximal contiene un exón terminal omitido y codifica la proteína calcitonina. El otro, con el uso de PAS distal, genera un ARNm que codifica el péptido 1 relacionado con el gen de la calcitonina (CGRP). La expresión de estas dos isoformas es específica de tejido. El ARNm de calcitonina se enriquece en la tiroides y el otro se enriquece en el hipotálamo [77]. Todos estos estudios demostraron que UR-APA es un ingrediente crucial de la versatilidad genética y que, en muchos casos, cada una de estas muchas isoformas de transcripciones y proteínas puede realizar funciones únicas.


Opciones de acceso

Obtenga acceso completo a la revista durante 1 año

Todos los precios son precios NETOS.
El IVA se agregará más adelante en el proceso de pago.
El cálculo de impuestos se finalizará durante el pago.

Obtenga acceso a artículos por tiempo limitado o completo en ReadCube.

Todos los precios son precios NETOS.


MATERIALES Y MÉTODOS

Líneas celulares y cultivo celular.

Los queratinocitos humanos normales (NHK) se derivaron del epitelio del prepucio humano neonatal como se describió previamente y se mantuvieron en medio de crecimiento de queratinocitos sin suero (clonéticos) (16). La línea de queratinocitos LKP-31 mantiene el genoma del VPH-31 en forma episomal y ha sido descrita previamente (41). La línea CIN-612 se derivó de una biopsia cervical (5). Las células SCC13 son una línea de carcinoma de células escamosas humano (38). Las células LKP-31, CIN-612 y SCC13 se mantuvieron en medio E con alimentadores de fibroblastos tratados con mitomicina C (Boehringer Mannheim) (31). Para inducir la diferenciación, las células se suspendieron en medio semisólido que contenía metilcelulosa 1,6 & # x00025 como se describió previamente (41). Para los ensayos de expresión transitoria, se transfectaron células CIN-612 o LKP-31 con 0.5 & # x003bcg de cada construcción informadora y 2.5 & # x003bcg de pSP72 (Promega) usando Lipofectamine (Gibco-BRL) en Opti-MEM (Gibco-BRL ) de acuerdo con las instrucciones del fabricante. A las 24 h después de la transfección, se retiraron los alimentadores de fibroblastos con solución salina tamponada con fosfato que contenía EDTA 0,5 mM, y los queratinocitos se dividieron en medio semisólido o en fibroblastos recién tratados. Después de 24 h, se determinaron las actividades de luciferasa mediante el sistema de ensayo indicador de luciferasa dual (Promega) de acuerdo con las instrucciones del fabricante.

Transfección de NHK.

La transfección de ADN viral en NHK ha sido descrita por Frattini et al. (11). Brevemente, para eliminar las secuencias del vector bacteriano, se digirieron 10.0 & # x003bcg del plásmido p599-HPV31 y los mutantes con HindIII durante la noche, seguido de inactivación por calor. Los plásmidos se ligaron a una concentración de 10 ng / & # x003bcl usando ADN ligasa de T4 (10 U / 900 & # x003bcl) a 16 & # x000b0C durante la noche (Gibco-BRL). El ADN se precipitó con alcohol isopropílico y se resuspendió en tampón TE (Tris-Cl 10 mM & # x0005bpH 7.4rsqb & # x0005d, EDTA 1,0 mM). Toda la ligadura precipitada se cotransfectó con 2,0 & # x003bcg de pSV2Neo en NHK con Lipofectace (Gibco-BRL) de acuerdo con las instrucciones del fabricante. Las células transfectadas se colocaron en placas sobre alimentadores de fibroblastos J2 tratados con mitomicina en medio E 1 día después de la transfección. La selección comenzó 2 días después de la transfección con G418 (200 & # x003bcg / ml) (Gibco-BRL) cada 2 días durante un total de 4 días, y luego G418 a 100 & # x003bcg / ml cada 2 días durante 4 días más. Después de la selección, las poblaciones agrupadas se expandieron para su análisis.

Plásmidos recombinantes.

El plásmido p599-31WT es un derivado de pBR322-HPV31 que contiene una versión modificada de pBR322 (11, 14). pBR322 fue digerido con Clayo y Eco47III, rellenado con fragmento de Klenow y ligado. El pBR322 mínimo resultante se digirió con EcoRI y una costumbre EcoRI y HinSe insertó el enlazador del adaptador dIII (5 & # x02032-AATTTTAAGCTTAA). El genoma de HPV-31 se obtuvo a partir de pBR322-HPV31 mediante digestión con EcoRI, ligado e insertado en el Hinsitio dIII del plásmido pBR322 modificado. p599-31CP (CP) se creó mediante mutagénesis por PCR, reemplazando el elemento AAUAAA temprano con la secuencia GGATCC. El producto 5 & # x02032 se obtuvo mediante amplificación por PCR utilizando un cebador corriente arriba en el nucleótido (nt) 3361 de HPV-31 (5 & # x02032-cgggtaccgagctcGAATTCC) que contiene un EcoSitio RI y un cebador aguas abajo en nt 4170 (5 & # x02032-GGTAATAATAAAAAAAAAGTAAAAAAGggatccATACCAATACCA), donde las letras mayúsculas indican la secuencia de HPV-31 y las letras minúsculas indican sitios de enzimas de restricción o secuencia aleatoria. El producto 3 & # x02032 se obtuvo mediante amplificación por PCR utilizando un cebador corriente arriba en el nt 4121 (5 & # x02032-GGTATTGTATTGGTATggatccCTTTACTTTTTTTTTATTATTACC) y un cebador corriente abajo en el nt 4697 (5 & # x02032-ggagatctGCAGGCT). Los productos se combinaron y amplificaron utilizando los cebadores originales en el nt 3361 y 4697, y la especie final se insertó en el EcoRI y PpuSitios MI de p599-HPV31. p599-31CP también carece de una de las seis secuencias repetidas, GGTATT, inmediatamente aguas arriba de la sustitución AAUAAA que no parece influir en la actividad de lectura completa cuando se sustituyeron múltiples repeticiones en pPolyA Luc-C15.2. El plásmido p599-31LD (LD) se elaboró ​​mediante el mismo enfoque, haciendo un producto 5 & # x02032 usando un cebador corriente abajo en nt 4195 (5 & # x02032-caacatacacaacacacaccCGCATGGTAATAATAAAA) y un producto 3 & # x02032 usando un imprimador corriente arriba en & # 4177 (5 & # x02032-caacatacacaacacacaccCGCATGGTAATAATAAAA) x02032-gtgtgtgttgtgtatgttgGCACTAACGTGCGTC). El plásmido p599-31SV (SV) se construyó clonando la señal de poliadenilación tardía del virus de simio 40 (SV40) de pGL3-Basic (Promega) en p599-31WT usando AvrII en el nt 4071 y BglII en el nt 4165. El AvrII y BglLos sitios II en HPV-31WT se crearon mediante mutagénesis por PCR. El plásmido p599-31BL (BL) se construyó mediante mutagénesis por PCR, reemplazando nt 4219 a 5022 de p599-31WT con la secuencia del gen de la galactosidasa & # x003b2. El producto 5 & # x02032 se obtuvo por amplificación por PCR usando p599-31WT, el cebador corriente arriba en el nt 3361 y un cebador corriente abajo en el nt 4217 (5 & # x02032-cactccaggatccGTAGCAGACGCACGTTTAGTG). El producto 3 & # x02032 se produjo como se describe a continuación en la construcción del plásmido indicador de luciferasa pPolyA Luc-BL8. Los productos se combinaron, amplificaron utilizando los cebadores externos y se insertaron en el EcoRI y StuI sitios de p599-31WT. Todas las secuencias producidas mediante amplificación por PCR para genomas recombinantes se secuenciaron en su totalidad (Centro de Biotecnología de la Universidad Northwestern). El plásmido p599-BL también contiene una sustitución inadvertida en el nt 3448 que es silenciosa en E2 pero altera la secuencia codificante de E4. Los estudios han demostrado que las mutaciones en E4 no tienen ningún efecto sobre la replicación transitoria (D. J. Klumpp y L. A. Laimins, datos no publicados). Los vectores de expresión de HPV-31 E1 y E2 pSG-E1 y -E2, respectivamente, se basan en pSG5 (Stratagene) y han sido descritos por Frattini y Laimins (9). El plásmido pSL1 & # x020132 contiene el cDNA E1 & # x02227E4, L1 de células CIN-612 entre nt 877 y 5760 de HPV-31 (21).

Plásmidos informadores de luciferasa. (i) Mutaciones del sitio poli (A).

El plásmido pPolyA Luc-Control se ha descrito previamente (46). El plásmido pPolyA Luc-1500 se creó mediante amplificación por PCR de p599-31WT utilizando un cebador corriente arriba en el nt 3797 que contiene un EcoSitio RI (5 & # x02032-atagaattcATATGACTATTTAGCCTAATG) y un cebador corriente abajo en el nt 5679 que contiene un BglII sitio (5 & # x02032 ggagatctAGCAGCCTAGCACTGCCTG). El amplicón se clonó en el EcoRI y BamSitios HI de pPolyA Luc-Control. Los plásmidos que contienen mutaciones en la señal de poliadenilación temprana y el ORF de L2 se construyeron utilizando el indicador pPolyA Luc-1500. pPolyA Luc-P15.1 se creó mediante amplificación por PCR de p599-31CP, que carece del elemento AAUAAA en el nt 4138. El indicador pPolyA Luc-P15.2 se produjo mediante mutagénesis por PCR utilizando p599-31WT y contiene sustituciones en ambos elementos UAUAUA para CGGCCG en nt 3999 y CCCGGG en nt 4014. pPolyA Luc-C15.1 se construyó reemplazando la secuencia GGTATTGGTATTGGTATTGGT entre nt 4103 y 4123 con ACGTAACCGTACACCTACAGCA. El plásmido pPolyA Luc-C15.2 se construyó reemplazando ACTTTTTTTTT en el nt 4151 a 4161 con CGAACACCCAT. pPolyA Luc-C15.3 se preparó sustituyendo AACGTGCGTCTGCT con GTCAAACCACAACC en el nt 4202 a 4215.pPolyA Luc-L15 y pPolyA Luc-SV15 contienen el sitio de unión de CstF tardío y la señal de poliadenilación tardía de SV40, respectivamente, como se describió anteriormente, producidas por amplificación por PCR y clonadas en pPolyA Luc-1500.

(ii) Plásmidos informadores de luciferasa con mutaciones de sustitución L2.

El plásmido pPolyA Luc-E15 se creó mediante amplificación por PCR del ORF de HPV-31 E1 entre nt 901 y 2350 utilizando cebadores que contienen BamHola y EagYo sitios. El producto de PCR se clonó en el BamHola y EagI sitios de pPolyA Luc-1500. los BamEl sitio HI se creó en pPolyA Luc-1500 mediante mutagénesis por PCR en el nt 4218. pPolyA Luc-EL8 contiene la secuencia de nt 901 a 1695 del ORF de E1 entre los BamHola y StuI sitios de pPolyA Luc-1500. El indicador pPolyA Luc-LE8 se preparó mediante amplificación por PCR de E1 nt 1724 a 2350, que contiene Stuyo y EagI sitios, y clonado en el Stuyo y EagI sitios de pPolyA Luc-1500. pPolyA Luc-EL4 se preparó mediante una reacción de amplificación por PCR de dos pasos. La secuencia E1 se obtuvo mediante amplificación por PCR de nt 901 a 1296 (cebador aguas abajo, 5 & # x02032-CATGTGTGCTACTGTACCATCTGCTGC). La secuencia L2 se preparó mediante amplificación por PCR de nt 4620 a 5128 (cebador cadena arriba, 5 & # x02032-ATGGTACAGTAGCACACATGAAAATCCTAC). A continuación, los productos de la PCR se amplificaron utilizando cebadores en E1 en el nt 901 y en L2 en el nt 5128 que contenían BamHola y StuI y creé una secuencia híbrida E1-L2. La secuencia fue clonada en el BamHola y StuI sitios de pPolyA Luc-1500. El plásmido pPolyA Luc-LE4 se creó mediante amplificación por PCR de L2 en los nt 4018 a 4620 (cebador aguas abajo, 5 & # x02032-GTTGTTTGTTGCTCCTCTAGAACACTTGTTACATCTAAAAGT) y de E1 en los nt 1298 a 1695 (cebador aguas arriba, 5 & #AAGGAAGCA-ACT). Los productos de PCR se combinaron y amplificaron usando cebadores en L2 en el nt 4018 que contenían un BamHI y en E1 en el nt 1695 que contiene un StuYo sitio. El producto de PCR híbrido L2-E1 se clonó en el BamHola y StuI sitios de pPolyA Luc-1500. El indicador pPolyA Luc-BL8 se construyó mediante amplificación por PCR del gen de la & # x003b2-galactosidasa en los nt 906 a 1701 de pSV - & # x003b2-galactosidasa (Promega) utilizando cebadores que contenían BamHola y StuYo sitios. El producto se clonó en el BamHola y StuI sitios de pPolyA Luc-1500. El plásmido pPolyA Luc-CPB se creó mediante una reacción de amplificación por PCR en dos pasos. El producto 5 & # x02032 se obtuvo mediante amplificación por PCR de nt 3797 a 4223 a partir de pPolyA Luc-P15.1, mientras que el producto 3 & # x02032 se obtuvo mediante amplificación por PCR de nt 4211 a 5022 a partir de pPolyA Luc-BL8. Los productos se amplificaron por PCR con cebadores en nt 3797 y nt 5022, que contenían BamHola y StuI, respectivamente, y se inserta en el BamHola y StuI sitios de pPolyA Luc-1500.

Ensayos de replicación transitoria.

Los ensayos de replicación transitoria se completaron como se describió anteriormente (20). Brevemente, el ADN viral se digirió con HindIII y ligado unimolecularmente. Las muestras se combinaron con ADN portador y cantidades equimolares de plásmidos de expresión E1 y E2 (pSG-E1 y pSG-E2). Se transfectaron células SCC13 mediante electroporación a 250 V, 960 & # x003bcF (Bio-Rad GenePulser) y se colocaron en placas sobre alimentadores de fibroblastos tratados con mitomicina C. A los 5 días posteriores a la transfección, se aisló ADN de bajo peso molecular mediante extracción de Hirt (18). Las muestras se digirieron con DpnI para eliminar el ADN metilado residual y con ProhibiciónII para linealizar genomas virales. Después de la electroforesis en gel de agarosa y la transferencia a una membrana de nailon (Magna Micron Separations), se detectó el ADN con una sonda de ADN de HPV-31 radiomarcada (HpaI-EcoFragmento RI) y examinado por autorradiografía.

Análisis de transferencia Southern.

El ADN genómico total de los transfectantes se aisló resuspendiendo los sedimentos celulares en tampón de lisis (NaCl 400 mM, Tris-Cl 10 mM & # x0005bpH 7.4 & # x0005d, EDTA 10 mM). Las muestras se incubaron durante la noche a 37 ° C con 50 ° C de proteinasa K por ml y 0,2% de dodecil sulfato de sodio (SDS). El ADN se cortó pasándolo a través de una aguja 10 & # x000d7 de calibre 18 y se extrajo con fenol-cloroformo. Las muestras se trataron con RNasa A (50 & # x003 bcg / ml) a 37 & # x000b0C durante 1 h, seguido de extracción con fenol-cloroformo y precipitación con etanol. Las transferencias de Southern se completaron usando 10.0 & # x003bcg de ADN total digerido con DpnYo y / o BlpI. Las muestras digeridas se procesaron en un gel de agarosa 0,8 & # x00025 durante la noche y se transfirieron alcalinas a membranas de nailon GeneScreen Plus (NEN). Las membranas se prehibridaron en 50 & # x00025 (vol / vol) formamida & # x020134 & # x000d7 fosfato salino estándar (NaCl 0,18 M, fosfato 10 mM & # x0005bpH 7,4 & # x0005d, EDTA 1,0 mM) & # x020135 & # x000d7 Solución de Denhardt (0,02 & # x000d7 # x00025 polivinilpirrolidona, 0.02 & # x00025 Ficoll, 0.02 & # x00025 albúmina de suero bovino) & # x020131.0 & # x00025 SDS & # x0201310 & # x00025 (vol / vol) sulfato de dextrano & # x020130.1 mg de ADN de esperma de arenque desnaturalizado por ml para 1 ha 42 & # x000b0C. La sonda de HPV-31 se preparó mediante purificación en gel de un XbaI-HindIII y marcado con el kit de etiquetado de ADN Ready-to-go (Amersham Pharmacia). La sonda marcada se purificó con microcolumnas Probe Quant G-50 (Amersham Pharmacia), se desnaturalizó y se añadió a una solución de hibridación reciente, que se incubó durante la noche a 42 ° C. La membrana se lavó dos veces con 2 & # x000d7 SSC (1 & # x000d7 SSC es NaCl 0,15 M más citrato de sodio 0015 M) & # x020130.1 & # x00025 SDS durante 15 min a temperatura ambiente, dos veces con 0,5 & # x000d7 SSC & # x020130. 1 & # x00025 SDS durante 15 min a temperatura ambiente, y una vez con 0.1 & # x000d7 SSC & # x020131.0 & # x00025 SDS durante 30 min a 50 & # x000b0C. Las membranas se visualizaron mediante autorradiografía y se cuantificaron mediante imágenes de fósforo.

Análisis de RT-PCR en tiempo real.

La transcripción inversa cuantitativa (RT) -PCR se completó utilizando el LightCycler Instrument (Roche) y el kit de amplificación de ARN SYBR Green I (Roche) de acuerdo con las instrucciones del fabricante. Los patrones de ARN se prepararon mediante reacciones de transcripción in vitro utilizando el plásmido linealizado pSL1 & # x020132 y el sistema de combinación Riboprobe T3 / T7 (Promega) de acuerdo con las instrucciones del fabricante. Las reacciones de transcripción in vitro se trataron con DNasa I para eliminar el ADN molde, se extrajo con fenol-cloroformo y se precipitó con etanol antes de su uso. Los transcritos que contienen el sitio de empalme E1 & # x02227E4 se amplificaron usando un cebador corriente arriba en el nt 770 (5 & # x02032-AGCACACAAGTAGATATTCGC) y un cebador corriente abajo en el nt 3487 (5 & # x02032-GTCGCCTCGCAACAACTTG), amplificando un producto de ARN empalmado 301-nt. Los transcritos que contienen el sitio de empalme E4 & # x02227L1 se amplificaron mediante un cebador corriente arriba en el nt 3408 (5 & # x02032-CGACGACGTCTACTAAGCG) y un cebador corriente abajo en el nt 5696 (5 & # x02032-ATGGATGGCCTACTGTAAGC), amplificando un producto de ARN empalmado de 328-nt. El ARN molde se preparó como se describió anteriormente. La RT-PCR se completó usando 2,0 & # x003bcg de ARN celular total a menos que se indique lo contrario. El perfil del ciclo fue el siguiente, usando una pendiente de 20 & # x000b0C / s: transcripción inversa, 55 & # x000b0C durante 10 min, desnaturalización a 95 & # x000b0C durante 30 s, y amplificación a 95 & # x000b0C durante 1 s, 58 & # x000b0C para 10 sy 72 & # x000b0C durante 14 s (pendiente, 2 & # x000b0C / s) para 45 ciclos y curva de fusión, 97 & # x000b0C durante 0 s, 65 & # x000b0C durante 20 sy 99 & # x000b0C durante 0 s (pendiente, 0,1 & # x000b0C / s). La adquisición de fluorescencia se completó como una lectura única después de cada ciclo de amplificación y como una lectura continua durante la curva de fusión. La especificidad del producto se determinó mediante análisis de pico de fusión y electroforesis en gel de agarosa (datos no mostrados).


Redes

La teoría de juegos tiene lugar en los niveles más básicos de la comunicación animal, me di cuenta mientras estaba sentado en mi clase de Introducción al comportamiento animal. La comunicación animal involucra un remitente y un receptor. Un remitente comunica una señal a un receptor y el receptor actúa sobre la señal. En algunos casos, una señal puede ser "honesta", lo que significa que el remitente muestra una señal confiable. Una señal "deshonesta" es cuando el remitente envía información falsa a un receptor. Como se detalla a continuación, los animales tienen que reconciliarse si quieren enviar tales señales o no, ya que enviar tales señales también puede ponerlos en peligro. Esta reconciliación, o la decisión de costo-beneficio que deben tomar, es un ejemplo de la teoría de juegos en acción.

Los pavos reales tienen plumas de colores extravagantes que atraen a otros pavos reales. Cuanto más brillantes son los colores, más atractivos parecen los pavos reales para sus posibles compañeros. Sin embargo, abrir sus coloridas colas es una señal costosa, ya que los pavos reales corren el riesgo de ser vistos por depredadores. La teoría de juegos entra en juego cuando los pavos reales deben elegir si deben abrir la cola para atraer a las hembras o arriesgarse a ser atrapados por los depredadores. En este caso, los campesinos tienen que decidir si el costo supera los beneficios. Si están lo suficientemente en forma para correr más rápido que los depredadores y están listos para aparearse, pueden optar por correr el riesgo y enviar su señal a las pavas. Sin embargo, pueden decidir no mostrar sus colores si deciden que son demasiado débiles para huir de un depredador al acecho.

La señalización deshonesta, aunque no lo parezca, puede ser una señal que los animales también transmiten por su propia cuenta. El cangrejo violinista, conocido por su única garra grande, debe luchar con otros cangrejos machos para conquistar a la hembra. Si un cangrejo violinista pierde su garra en la pelea, otra garra crece en su lugar. Esta garra de repuesto es más ligera y tampoco tan eficaz como la original. El cangrejo todavía puede asustar a otros compañeros con su garra. Su garra regenerada envía una señal deshonesta a otros machos de que es fuerte y capaz de luchar. Además, su garra todavía atrae a las hembras que no se dan cuenta del cambio en el peso de la garra. Sin embargo, si es desafiado en una pelea con otro cangrejo violinista, probablemente perderá. En este caso, el cangrejo también está jugando con la teoría de juegos. Puede elegir enviar una señal a los otros machos mostrando su garra. En algunos casos, lucirse puede terminar asustando a otros machos y él puede terminar teniendo a la hembra. En otros casos, puede mostrar su garra y terminar siendo desafiado a un duelo que no ganaría.


Resultados

La entrada en reposo da como resultado la regulación a la baja de los genes involucrados en el ciclo celular, el procesamiento del ARNm y la motilidad.

Se aislaron fibroblastos dérmicos humanos primarios a partir de muestras de piel humana, como se describió anteriormente [24]. Los fibroblastos aislados de dos donantes diferentes se recogieron en condiciones de proliferación o después de haber sido inducidos a la inactividad por 7 días de inhibición por contacto (7dCI) de la proliferación [7]. Se realizaron análisis de RNA-Seq y microarrays para determinar los cambios en la expresión génica entre tres muestras de células 7dCI en proliferación y emparejadas (Fig. 1a y archivo adicional 1: Tabla S1) [25]. Entre los 19.673 genes monitorizados, las transcripciones de los genes de 1993 (10,1%) cambiaron en expresión dos veces o más, lo que demuestra cambios generalizados en la expresión génica con quiescencia inducida por inhibición por contacto (Fig. 1b). Los niveles de expresión para el 52% de estos genes se regularon positivamente en 7dCI en comparación con los fibroblastos en proliferación, y el 48% se regularon negativamente en los fibroblastos de 7dCI. La correlación entre las réplicas biológicas analizadas por RNA-Seq fue alta (R 2 valores mayores o iguales a 0,83) (Archivo adicional 1: Figura S1A). Cuando se analizaron las mismas muestras con microarrays, la expresión génica diferencial detectada por microarrays coincidió en gran medida con la detectada por RNA-Seq (r 2 = 0.785, pag & lt 0.001) (Archivo adicional 1: Figura S1B). Además, los cambios en la expresión génica detectados por RNA-Seq se correlacionaron bien con el "programa de quiescencia" publicado anteriormente de cambios en la expresión génica identificados en fibroblastos inducidos en quiescencia por múltiples condiciones independientes [9] (Archivo adicional 1: Figura S1C). Los hallazgos apoyan estudios previos que muestran que la inactividad está asociada con la regulación de una fracción significativa del genoma [9, 10, 26].

Análisis de RNA-Seq de cambios en la expresión génica en fibroblastos en proliferación versus quiescentes. a Esquema del análisis basado en RNA-Seq de fibroblastos en proliferación y en reposo realizado en este estudio. B El ARN total se aisló de tres réplicas biológicas independientes de fibroblastos en proliferación y tres réplicas biológicas independientes emparejadas de fibroblastos 7dCI. Las muestras de ARN se convirtieron en bibliotecas de ADNc y se secuenciaron en un Illumina Hi-Seq 2000. Las lecturas se alinearon con el genoma humano (secuencia de referencia humana hg19) y se determinó el número de lecturas que mapean cada gen (anotación del gen UCSC) en el genoma. Se muestra un mapa de calor de recuentos de lectura para los genes de 1993 con al menos un cambio doble en la expresión y una tasa de descubrimiento falso (FDR) & lt 5%. La agrupación jerárquica se indica mediante el dendrograma a la izquierda del mapa de calor. En la esquina superior izquierda se muestran una clave de color y un histograma que muestra la densidad de genes con una intensidad de color determinada. C El análisis de enriquecimiento de conjuntos de genes se utilizó para determinar los conjuntos de genes más significativamente regulados al alza (arriba) o regulados a la baja (abajo) con quiescencia. Los conjuntos de genes se enumeran en orden descendente de importancia estadística de izquierda a derecha. Un histograma del registro2(cambio de veces) del recuento de lectura normalizado en 7dCI en comparación con la proliferación de fibroblastos para cada gen en el conjunto de genes se representa en una representación gráfica de violín. D Se proporcionan mapas de calor de genes dentro de categorías de enriquecimiento de conjuntos de genes seleccionados. El registro2 Se muestra la relación de recuentos de RNA-Seq normalizados en 7dCI en comparación con fibroblastos en proliferación. El rojo indica una mayor expresión en fibroblastos en reposo que en proliferación. El verde indica una mayor expresión en fibroblastos en proliferación que en fibroblastos en reposo. Solo se incluyen los genes de cada categoría que cambian en la expresión dos veces o más.

El análisis de enriquecimiento de conjuntos de genes (GSEA) [27, 28] reveló que la expresión de los genes implicados en la replicación del ADN y la regulación del ciclo celular estaba regulada a la baja en 7dCI en comparación con la proliferación de fibroblastos (Fig. 1c), de acuerdo con la salida del ciclo celular en condiciones de inhibición por contacto. La expresión de genes asociados con la remodelación de la matriz extracelular y el metabolismo del colágeno se reguló positivamente con la quiescencia (Fig. 1c, d), de acuerdo con nuestros hallazgos anteriores [6, 7]. De hecho, COL21A1, un colágeno que se encuentra asociado con el colágeno I, se encuentra entre los genes inducidos con mayor fuerza en la inactividad en comparación con los fibroblastos en proliferación (archivo adicional 1: Tabla S2). La expresión de genes en las categorías de deslizamiento de filamentos musculares, regulación de la contracción muscular, movimiento y contracción muscular se reguló negativamente en los fibroblastos inhibidos por contacto en comparación con la proliferación de fibroblastos (Fig. 1c, d). Cuatro genes implicados en la motilidad celular se encontraban entre los genes más fuertemente regulados a la baja con quiescencia (KISS1, ACTC1, PODXL y RLTPR) (Tabla 1 y archivo adicional 1: Tabla S2). Por lo tanto, encontramos que los fibroblastos en proliferación expresan niveles más altos de transcripciones asociadas con la motilidad y la remodelación citoesquelética.

Las transcripciones asociadas con el empalme y la poliadenilación se regularon principalmente a la baja en 7dCI en comparación con la proliferación de fibroblastos (Fig. 1c, d), de acuerdo con informes anteriores [9, 21]. Las transcripciones que codifican muchas de las proteínas que se consideran componentes centrales del espliceosoma se regularon ligeramente a la baja en los fibroblastos inhibidos por contacto en comparación con la proliferación de fibroblastos (archivo adicional 1: Tabla S3), con tres genes que alcanzan significación estadística (U1C (reducción de 2,26 veces), PRPF4 (Reducción de 2,77 veces) y PPIH (reducción de 2,89 veces)). Los niveles de expresión de los factores de escisión y poliadenilación también se redujeron con la inactividad (archivo adicional 2). Presumimos que, además de los cambios en la expresión génica, las alteraciones en los eventos de procesamiento del ARNm entre fibroblastos en proliferación y en reposo también podrían contribuir a cambios funcionales en los estados de reposo y proliferación.

Los fibroblastos en reposo retienen más exones e intrones que los fibroblastos en proliferación

Para comprender mejor los cambios en el procesamiento de ARNm asociados con la proliferación, investigamos nuestros datos de ARN-Seq más a fondo para identificar ejemplos de sitio de inicio alternativo, empalme alternativo o poliadenilación alternativa. Aplicando el algoritmo DEXSeq [29], descubrimos exones de 1975, codificados dentro de 1218 genes, con expresión diferencial entre fibroblastos en proliferación y 7dCI (archivo adicional 3). Utilizando g: Profiler [30], encontramos que los genes que se someten a una expresión de isoformas alternativa en células en proliferación frente a células inactivas se enriquecen en categorías de unión de ARN, procesamiento de ARN, elongación de traducción y empalme de ARN (Tabla 2, archivo adicional 4). Por tanto, los genes implicados en el procesamiento del ARN tienen una probabilidad especial de ser procesados ​​alternativamente durante la transición entre la proliferación y la inactividad.

Para comprender mejor la frecuencia de tipos específicos de eventos de empalme que se produjeron de forma diferencial en fibroblastos en proliferación y en reposo, aplicamos el algoritmo computacional rMATS [31, 32, 33] (Fig. 2a, archivo adicional 5). Los exones omitidos (exones que están presentes en las células en proliferación, pero no en reposo, o viceversa) fueron el tipo de evento más común detectado (319 eventos, 53% de los eventos). De los eventos de empalme detectados por rMATS, el 39% también fueron detectados por DEXSeq. Se incluyeron preferentemente más exones en las condiciones de reposo en comparación con las condiciones de proliferación, que los de proliferación en comparación con las condiciones de reposo (1,5 veces, prueba exacta de Fisher, dos colas pag valor = 0.013) (Fig.2a). Estos eventos de cambio de exón brindan oportunidades para la regulación de la función de las proteínas en función de la inclusión o exclusión de exones individuales. Los intrones fueron retenidos significativamente más frecuentemente en los fibroblastos inactivos que en proliferación (3.7 veces, prueba exacta de Fisher, dos colas pag valor & lt 0,0001) (Fig. 2a). El 8.2% de las transcripciones asociadas con eventos de intrones retenidos se anotan como candidatos de desintegración mediada sin sentido (NMD) (18 transcripciones de NMD únicas / 220 transcripciones de retención de intrones únicos en total en la base de datos Ensembl). El análisis de ontología genética (GO) de los genes empalmados diferencialmente reveló que los genes que se someten a empalme alternativo con quiescencia se enriquecen para las categorías de unión de ARN, procesamiento de ARN y empalme de ARN (Tabla 2 y archivo adicional 6), de acuerdo con una creciente literatura que demuestra que los genes implicados en el empalme de ARNm están regulados por eventos de empalme [30, 34,35,36,37].

Empalme diferencial en fibroblastos proliferantes y en reposo. a Se aplicó rMATS a los datos de RNA-Seq de tres réplicas biológicas de fibroblastos en proliferación y tres réplicas biológicas de fibroblastos inhibidos por contacto. Se muestran los eventos de empalme con un FDR & lt 0.05. Se informa el número total de eventos de empalme. Entre paréntesis, se proporciona el número de eventos con mayor inclusión en fibroblastos en proliferación, seguido del número de eventos con mayor inclusión en fibroblastos inactivos. Los exones omitidos eran significativamente más propensos a incluirse en los fibroblastos inactivos (prueba exacta de Fisher, dos colas pag valor = 0,013). Los intrones eran significativamente más propensos a ser retenidos en fibroblastos inactivos (prueba exacta de Fisher, dos colas pag valor & lt 0,0001). B Inmunotransferencia de factores de corte y empalme en fibroblastos en proliferación y en reposo. Los niveles de factor de corte y empalme central U2AF65 fueron similares en fibroblastos en proliferación y en reposo. El U1-70 K y los factores auxiliares TRA2β y FUS se expresaron a niveles más bajos en 7dCI y 7dSS en comparación con los fibroblastos en proliferación. La α-tubulina se analizó como control de carga. La proporción de factor de empalme a tubulina, normalizada a células en proliferación, se muestra a continuación. C Se proporcionan logotipos de secuencia [120] para las secuencias 5 'y 3' para los exones que se cortan y empalman constitutivamente, y los intrones que se retienen preferentemente en las células en proliferación o en reposo. los y-eje indica bits de información [121]. Las secuencias del sitio de empalme 3 'fueron diferentes entre las condiciones proliferativas y las constitutivas (pag valor & lt 0.01 para condiciones constitutivas versus retenidas en condiciones de proliferación, ANOVA con la prueba de comparación múltiple de Tukey) y condiciones inactivas versus constitutivas (pag valor & lt 0.01 para constitutivo versus retenido en condiciones de reposo)

Algunos factores auxiliares de empalme están regulados a la baja en fibroblastos inactivos

Para comprender los cambios en el empalme en reposo en comparación con la proliferación de fibroblastos, investigamos los cambios en la expresión de factores de empalme. Nuestros datos de RNA-Seq revelaron que la expresión de genes de empalme de ARN está modestamente regulada a la baja en fibroblastos inhibidos por contacto (Fig. 1c, dy Archivo adicional 1: Tabla S3). Monitoreamos los niveles de proteína de factores de corte y empalme con inmunotransferencia en fibroblastos que estaban proliferando o inducidos a la inactividad por 7 días de inhibición por contacto (7dCI) o por inanición de suero (7dSS). Los niveles de factor de corte y empalme esencial U2AF65 fueron similares en los fibroblastos en proliferación y en reposo. Los niveles del factor central U1-70K y los factores auxiliares TRA2β y FUS se regularon negativamente en reposo en comparación con los fibroblastos inhibidos por contacto (Fig. 2b). Los niveles más bajos de algunos factores de corte y empalme en fibroblastos inactivos pueden contribuir a una mayor retención de intrones en condiciones inactivas [38, 39].

Sitios de empalme más débiles para intrones retenidos

Además de niveles más bajos de factores de empalme, la retención de intrones se ha asociado con sitios de empalme débiles [40, 41]. Para comprender mejor por qué algunos intrones se retienen en células en proliferación o en reposo, analizamos hasta qué punto los sitios de empalme 5 ′ (9 nt de longitud) y los sitios de empalme 3 ′ (23 nt) de intrones retenidos diferencialmente coinciden con los sitios de empalme de consenso [42] . Determinamos la probabilidad de observar cada secuencia dada la matriz de peso de posición para los sitios de empalme de consenso. Las secuencias en los sitios de corte y empalme para intrones retenidos diferencialmente en estados de proliferación o de reposo coincidían menos con la secuencia consenso que las secuencias cerca de exones empalmados constitutivamente, con un fuerte efecto en el sitio de corte y empalme 3 '(Fig. 2c). Estos hallazgos son consistentes con estudios previos que también mostraron que los sitios de empalme 3 'están enriquecidos para C en comparación con T en los tractos de polipirimidina de intrones que se retienen [43]. Por tanto, en fibroblastos proliferantes que tienen niveles más altos de la mayoría de los factores de corte y empalme, la retención de intrones puede ser especialmente sensible a la secuencia de corte y empalme 3 '.

Un cambio hacia el uso de sitios de poliadenilación más distales en reposo

En estudios previos se ha observado un cambio hacia el uso de sitios de poliadenilación distales que mostraron que las células que no se dividen [21] y las células diferenciadas [18, 20, 44, 45] utilizan predominantemente sitios de poliadenilación distales, mientras que las células en proliferación [18, 21] ] y las líneas de células cancerosas [20, 45, 46] tienden a utilizar sitios de poliadenilación proximales. Nuestro análisis DEXSeq reveló que muchos de los cambios en la expresión de isoformas detectados entre fibroblastos en proliferación y 7dCI implican el último exón del transcrito analizado y darían como resultado un cambio en el sitio de poliadenilación. Por ejemplo, la forma invertida, el dominio FH2 y WH2 (INF2) y el hermano de CDO (BOC) (Fig. 3a) exhiben un uso alternativo de exones terminales en fibroblastos proliferantes y 7dCI. La PCR en tiempo real con cebadores específicos de isoformas confirmó que tanto para INF2 como para BOC, la transición a la inactividad en respuesta a 7dCI o 7dSS dio como resultado un cambio en la selección del sitio de poliadenilación (Fig. 3b). Para INF2, el efecto más fuerte fue una disminución en el uso del sitio de poliadenilación proximal. Para BOC, el efecto más fuerte fue un aumento en el uso del sitio de poliadenilación distal en fibroblastos inactivos. La reestimulación de los fibroblastos de 7dCI a un estado proliferativo dio como resultado una reversión hacia un perfil de selección del sitio de poliadenilación más similar al de las células en proliferación tanto para INF2 como para BOC.

Uso de sitios de poliadenilación distales y niveles más bajos de factores de escisión y poliadenilación durante la quiescencia. a Vistas del navegador UCSC Genome que muestran las isoformas largas y cortas de INF2 y BOC. El exón expresado diferencialmente se resalta en cian. B Validación por PCR en tiempo real de APA con quiescencia. Las muestras de ADNc generadas a partir de fibroblastos que estaban proliferando, inactivos por inhibición por contacto o inanición de suero, o inducidos en inactividad por inanición de suero y luego reestimuladas, se analizaron con PCR en tiempo real. Los cebadores se diseñaron para reconocer las isoformas cortas (que terminan en el sitio de poliadenilación proximal) o largas (que terminan en el sitio de poliadenilación distal) de INF2 o BOC. La transición de los fibroblastos a la inactividad dio como resultado una expresión reducida de la isoforma corta de INF2 y una expresión aumentada de la isoforma larga de BOC. La reestimulación de los fibroblastos inactivos dio como resultado patrones de expresión de las isoformas cortas y largas que se asemejan más a las células en proliferación. Los gráficos muestran puntos de datos individuales como puntos. Los gráficos de barras representan la media y la media ± S.D. El número de réplicas para todas las condiciones para INF2 corto y largo es 3. El número de réplicas para todas las condiciones para BOC largo es 3. El número de réplicas para P, 7dCI y 7dCI-R para BOC corto es 3. El número de réplicas para 7dSS para BOC corto es 2. La significación estadística en las células knockdown en comparación con las células de control se determinó para isoformas largas y cortas con dos colas, no emparejadas t pruebas. Para todas las figuras, un asterisco indica pag valor & lt 0.05. Dos asteriscos indican pag valor & lt 0.01. Tres asteriscos indican pag valor & lt 0,001. C Un cambio hacia la expresión de isoformas más largas en fibroblastos inactivos. La proliferación y el 7dCI se analizaron mediante RNA-Seq enriquecido en el sitio de poliadenilación. El uso relativo del sitio de poliadenilación distal (RUD) para genes individuales en fibroblastos en proliferación se representa en el eje xy el RUD para el mismo gen en condiciones de reposo se representa en el eje y. La línea negra discontinua indica y = X. El primer gráfico (izquierda) muestra todos los genes con dos sitios de poliadenilación detectados. El gráfico del medio muestra los genes UTR APA y el gráfico final (derecha) muestra los mismos datos para los genes que se someten a UR APA. D La inmunotransferencia se realizó en lisados ​​de proteínas recogidos de fibroblastos en proliferación, 7dCI y 7dSS para CstF-64, CFIm25 y CPSF73. La fosforilación de la serina 5 en el ARN pol II CTD se controló mediante inmunotransferencia y los niveles disminuyen con la quiescencia. La α-tubulina se monitorizó como control de carga.

Para generar un conjunto de datos a gran escala que definiría claramente los extremos 3 'de las transcripciones en fibroblastos en proliferación y en reposo (7dCI), aplicamos RNA-Seq enriquecido en el sitio de poliadenilación [47]. Con RNA-Seq enriquecido en el sitio de poliadenilación,

El 64% de todas las lecturas de secuenciación asignadas coincidieron con un sitio de poliadenilación (Archivo adicional 1: Tabla S4). Los datos de RNA-Seq enriquecidos en el sitio de poliadenilación se utilizaron para determinar el uso relativo del distal (RUD) (mapeo de lecturas en el sitio de poliadenilación distal / lecturas totales de los sitios de poliadenilación proximales y distales) para cada gen en condiciones de proliferación y 7dCI para genes detectados con dos sitios de poliadenilación (archivo adicional 7). Para genes con más de dos sitios de poliadenilación (archivo adicional 8), se utilizó un parámetro más general llamado uso relativo del sitio (lee el mapeo en un sitio de poliadenilación / lecturas totales de todos los sitios de poliadenilación). Los datos fueron altamente reproducibles cuando se compararon diferentes réplicas biológicas de muestras en proliferación y 7dCI (archivo adicional 1: Figura S2A). Utilizando RNA-Seq enriquecido en el sitio de poliadenilación, confirmamos el hallazgo anterior [21] de un cambio hacia el uso de sitios de poliadenilación más distales al entrar en el estado de reposo a través de la inhibición por contacto (Fig. 3c, archivo adicional 7). El ochenta y ocho por ciento (628 de 714) de los genes con dos sitios de poliadenilación, y con cambios significativos (| RUD | & gt 0.05) en la poliadenilación alternativa (APA) entre los dos estados celulares, fueron más largos (mayor uso de sitios pA distales en comparación a los sitios pA proximales) en el reposo en comparación con los fibroblastos en proliferación. Para 572 de estos 628 genes (91%), el sitio de poliadenilación proximal se localiza en la región no traducida 3 '(UTR denominada UTR APA) (Fig.3c), mientras que para el 9% restante de genes, se encuentra el sitio de poliadenilación proximal en la región corriente arriba de la 3´ UTR (región corriente arriba (UR) APA) incluyendo intrones y exones. Los genes con dos sitios de poliadenilación que se someten a APA con inactividad se enriquecieron en genes involucrados en el empalme y procesamiento de ARN (Tabla 2 y archivo adicional 9). Los genes que se someten a APA con inactividad también incluyen genes implicados en la migración celular (Tabla 1).

Niveles reducidos de factores de procesamiento de ARNm en fibroblastos inactivos

Para comprender mejor la regulación del uso del sitio de poliadenilación con quiescencia, monitoreamos los niveles de factores APA en fibroblastos proliferantes y quiescentes. La escisión y poliadenilación de las transcripciones de pre-ARNm están mediadas por la actividad coordinada de tres complejos de proteínas centrales [16]. El complejo del factor de especificidad de escisión y poliadenilación (CPSF) reconoce una secuencia hexámera (AAUAAA o una secuencia similar) en una región de 50 nt aguas arriba del sitio de escisión [48, 49] el pre-ARN 3 ', subunidad 2, 64 kDa ( La subunidad CSTF2 o CstF-64) del complejo CstF reconoce una región rica en U o rica en G / U aproximadamente 20-40 nucleótidos aguas abajo del sitio de escisión [19, 50,51,52,53] y Nudix (nucleósido difosfato unido el motivo 21 del tipo de resto X) (NUDT21 o CFIm25) reconoce las secuencias de UGUA corriente arriba de los sitios de escisión y poliadenilación [54]. CPSF73, un componente del complejo CPSF, es la endonucleasa que realiza el evento de escisión en la secuencia hexamérica [55]. Se han asociado niveles elevados de proteínas del complejo CSTF con el uso de sitios de poliadenilación proximales [19, 56, 57], mientras que se ha informado que el complejo CFIm reprime el uso de sitios de poliadenilación proximales [45, 57, 58]. Nuestros datos de RNA-Seq revelaron que la mayoría de los factores principales de poliadenilación y factores auxiliares asociados con la escisión y la poliadenilación están modestamente regulados a la baja en el nivel de transcripción en reposo en comparación con la proliferación de fibroblastos (archivo adicional 2). Entre los factores centrales, CstF-64 / CSTF2 está fuerte y significativamente (3,1 veces) regulado a la baja a nivel de transcripción. Usando inmunotransferencia, encontramos que los niveles de proteína de CstF-64, CPSF73 y CFIm25 son más bajos en 7dCI o 7dSS que en fibroblastos en proliferación (Fig. 3d). Al monitorear el grado de fosforilación de la serina 5 del dominio carboxiterminal (CTD) de ARN pol II como una indicación de la tasa de inicio de la transcripción [59] con inmunotransferencia, encontramos que la regulación a la baja de CstF-64 a nivel de proteína con quiescencia fue más fuerte que la reducción en la transcripción iniciación (Fig. 3d).

La eliminación de los factores de escisión y poliadenilación replica la selección del sitio de poliadenilación con quiescencia

Para comprender mejor el papel de los factores de escisión y poliadenilación en la selección del sitio de poliadenilación con quiescencia, introdujimos ARNip que se dirigen a CstF-64, CPSF73 o CFIm25, o un ARNip de control, en fibroblastos. Fuerte caída del gen objetivo se confirmó con PCR en tiempo real (archivo adicional 1: Figura S3). En comparación con las células de control, la eliminación de estos factores de poliadenilación no afectó significativamente la viabilidad celular (archivo adicional 1: Figura S4A y B). Probamos si la eliminación de la expresión de factores de escisión y poliadenilación da como resultado cambios en los niveles de isoformas más cortas y más largas de genes que se someten a APA con quiescencia utilizando cebadores de PCR en tiempo real diseñados para reconocer las isoformas cortas o largas de INF2 o BOC (Fig. . 3a). Para INF2, la eliminación de CstF-64 o CPSF73, pero no CFIm25, dio como resultado niveles reducidos de la isoforma corta de INF2 y un aumento en la isoforma larga de INF2 (Fig. 4a). Para BOC, la eliminación de CstF-64 o CPSF73, pero no CFIm25, dio como resultado niveles más bajos de la isoforma BOC corta (Fig. 4a). La caída de CstF-64 resultó en un aumento en la isoforma larga de BOC (Fig. 4a).

La eliminación de los factores de escisión y poliadenilación da como resultado cambios en el uso de isoformas y la expresión génica que se superponen con la inactividad. a La eliminación de los factores de escisión y poliadenilación induce un cambio en la expresión de isoformas. Se realizó PCR en tiempo real para las isoformas cortas y largas de INF2 y BOC en fibroblastos en proliferación que expresan un ARNip de control o un ARNip que se dirige a CFIm25, CstF-64 o CPSF73. La isoforma corta de INF2 o BOC se redujo significativamente en células transfectadas con un ARNip contra CstF64 o CPSF73. Los gráficos muestran puntos de datos individuales como puntos. Los gráficos de barras representan la media y la media ± S.D. El número de réplicas para control, eliminación de CFIm25 y CPSF73 para INF2 corto y largo es 6. El número de réplicas para eliminación de CstF64 para INF2 corto y largo es 3. El número de réplicas para todas las condiciones para BOC largo es 2, excepto el control , que tuvo 3 réplicas. El número de réplicas para control y eliminación de CFIm25 para BOC corto es 3. El número de repeticiones para eliminación de CstF64 y CPSF73 para BOC corto es 2. La significación estadística en las células de eliminación en comparación con las células de control se determinó para isoformas largas y cortas con dos colas. , pruebas t no emparejadas. B Superposición entre genes que se someten a APA con quiescencia y eliminación de factores de escisión y poliadenilación. La superposición entre genes que utilizan el sitio de poliadenilación proximal con quiescencia y utilizan un sitio de poliadenilación proximal preferentemente con caída de CFIm25 se muestra a la izquierda. La superposición entre genes que usan sitios de poliadenilación distales con quiescencia y genes que usan sitios de poliadenilación distales con eliminación de CPSF73 o CstF64 se muestran en el medio y a la derecha, respectivamente. C Superposición entre genes regulados positivamente con inactividad y genes regulados positivamente con caída de CstF-64 (izquierda) y superposición entre genes regulados negativamente con inactividad y genes regulados negativamente con caída de CstF-64 (derecha). La superposición entre grupos de genes se probó mediante la prueba hipergeométrica

Para monitorear los cambios globales de APA, realizamos una secuencia de ARN enriquecida en el sitio de poliadenilación de fibroblastos transfectados con un ARNip de control o un ARNip que se dirige a un factor de poliadenilación (CstF-64, CPSF73 o CFIm25) [47]. La caída en dos cepas diferentes de fibroblastos dio como resultado resultados altamente reproducibles (archivo adicional 1: Figura S2B). Cada derribo resultó en cambios significativos (| RUD | & gt 0.05) en la selección del sitio de poliadenilación, y el derribo de CFIm25 resultó en un cambio claro hacia el uso de sitios de poliadenilación más proximales (archivo adicional 1: Figura S4C y archivo adicional 10), de acuerdo con informes anteriores [60, 61]. Comparamos los genes que cambian el uso del sitio de poliadenilación con quiescencia con los resultados de la eliminación de cada factor de escisión y poliadenilación (Fig. 4b y archivo adicional 1: Figura S5A y B). Entre los tres factores de poliadenilación, la eliminación de CFIm25 resultó en el mayor número de genes que cambiaron a un mayor uso del sitio de poliadenilación proximal (isoformas más cortas) y la mayoría de los genes que se superponen con cambios a sitios de poliadenilación más proximales con quiescencia (Fig. 4b). y archivo adicional 1: Figura S5A). Observamos una superposición significativa entre los genes que usan sitios de poliadenilación más distales (cambio a isoformas más largas) con quiescencia y genes que usan sitios de poliadenilación más distales con eliminación de cada factor, con un mayor número de genes afectados por la caída de CstF-64 o CPSF73 (Fig. .4b y archivo adicional 1: Figura S5A). Algunos de estos cambios en el uso del sitio de poliadenilación fueron específicos de un factor, mientras que algunos fueron regulados por más de uno o incluso los tres factores (archivo adicional 1: Figura S5B). Para 626 genes únicos que cambian al uso del sitio de poliadenilación distal con quiescencia, 226 genes (36%) también cambian al uso del sitio de poliadenilación distal con la eliminación de uno o más factores de poliadenilación. Para 86 genes que cambian al uso del sitio de poliadenilación proximal con quiescencia, 38 (44%) también cambian al uso del sitio de poliadenilación proximal con la eliminación de uno o más factores de poliadenilación (archivo adicional 1: Figura S5B).

La eliminación de CstF-64 dio como resultado cambios en la expresión génica que se superponen significativamente con los cambios en la expresión génica con la inactividad (Fig. 4c y archivo adicional 11). Los cambios en la expresión génica tras la caída de CPSF73 y CFIm25 se superpusieron con los cambios en la expresión génica durante la inactividad también, pero participaron menos genes (archivo adicional 1: Figura S5C).

Se encontró que algunos de los genes que estaban regulados (cambios de APA o cambios de expresión génica) con la eliminación de CstF-64 estaban asociados con términos de GO relacionados con el movimiento celular (Tabla 3). Varios de estos genes de migración que experimentan cambios en APA tras la caída de CstF64 también lo hicieron con quiescencia, como la proteína compleja Arp2 / 3 ACTR2 y CDC42 y la proteína de unión a RAC1 IQGAP1.

Los sitios de reconocimiento del factor de escisión y poliadenilación son más frecuentes en genes que se someten al uso alternativo de isoformas con quiescencia

Para comprender mejor la importancia de diferentes factores de sitios de escisión y poliadenilación en el uso alternativo de sitios de poliadenilación con quiescencia, monitoreamos la presencia de sus motivos de reconocimiento (Fig. 5a). Para los genes que se someten a UR APA y cambian a un mayor uso de sitios de poliadenilación más distales durante la inactividad, es más probable que su sitio de poliadenilación proximal tenga un hexámero fuerte (AAUAAA o AUUAAA), y es menos probable que no tenga hexámero, que para los genes de control ( Figura 5b). De manera similar, cuando se derriba CPSF73, los genes que cambian a un mayor uso de los sitios de poliadenilación distal tienen menos probabilidades de no tener hexámero que los genes que no se alargan con la inactividad (archivo adicional 1: Figura S6). Los hallazgos apoyan el papel de los niveles reducidos de CPSF73 que contribuyen al uso de sitios de poliadenilación más distales en genes que experimentan UR APA en células inactivas.

Cambios en las secuencias de reconocimiento del sitio de poliadenilación en los sitios de poliadenilación proximal versus distal para genes que experimentan APA con quiescencia. a Esquema que muestra la posición relativa del motivo UGUA, hexámeros, el sitio de escisión y motivos ricos en GU / U. B Las frecuencias con las que diferentes posibles hexámeros están presentes en los sitios de poliadenilación proximales o distales se muestran para genes que tienen dos sitios de poliadenilación y cambian al uso de sitios de poliadenilación más distales con quiescencia (azul oscuro).Otros hexámeros son AAACAU, AAUAAC, UUAAAG, UUAAAU, UAUAAA, AAUACA, CAUAAA, AAUAUA, GAUAAA, AAUGAA, AAGAAA, ACUAAA, AAUAGA, AAUAAU, AACAAA, AUUACA, AUUAUA, AACAAG y. Los datos se comparan con los resultados de los genes que utilizan un sitio de poliadenilación proximal o que no cambian su uso del sitio de poliadenilación con quiescencia (azul claro). Se muestran datos para todos los genes, para los genes que se someten a UTR APA y para los genes que se someten a UR APA. Las diferencias estadísticamente significativas se determinaron mediante la prueba exacta de Fisher (C) Se muestra la fracción de genes con un motivo UGUA en la región aguas arriba del hexámero del sitio de poliadenilación. Se proporcionan datos para genes que cambian a un mayor uso de sitios de poliadenilación distal en reposo (azul oscuro) y un conjunto de genes de control que no utilizan sitios de poliadenilaton distal más con reposo (azul claro) (gráficos de la izquierda). También se proporcionan datos para genes que cambian a un mayor uso de sitios de poliadenilación proximales con quiescencia (marrón) y un conjunto de genes de control que no cambian a un mayor uso de sitios de poliadenilación proximales (rosa) (gráficos de la derecha) Las diferencias estadísticamente significativas se determinaron mediante prueba exacta de Fisher de dos colas. D Se muestra la fracción de genes con un motivo rico en U en la región aguas abajo del hexámero del sitio de poliadenilación. mi La fracción de pares de bases 20-40 nts aguas abajo del sitio de poliadenilación que son Us se muestra para los genes que cambian al uso de sitios de poliadenilación más distales con quiescencia. La significación estadística se determinó mediante la prueba de rango con signo de Wilcoxon

Extendiendo el análisis a los motivos UGUA reconocidos por CFIm25, entre los genes que usan UR APA para cambiar a un uso más distal del sitio de poliadenilación en células inactivas que en proliferación, hubo una probabilidad significativamente mayor de que un motivo UGUA estuviera presente en el sitio proximal que para un control. conjunto de genes (Fig. 5c). Con la caída de CFIm25, el efecto más fuerte fue un mayor uso de sitios de poliadenilación proximales, y los genes afectados tenían más probabilidades de tener un motivo UGUA en su sitio de poliadenilación distal (archivo adicional 1: Figura S7).

Para controlar la presencia de sitios de unión para CstF-64, determinamos la fracción de sitios de poliadenilación que contienen una cadena de cuatro o más uracilos en la región 20-40 pares de bases aguas abajo del sitio de poliadenilación. Con este análisis, hubo más motivos UUUU en los sitios de poliadenilación proximales entre los genes que cambian al uso de sitios más distales con quiescencia, pero la diferencia no fue estadísticamente significativa (0,098) (Fig. 5d). También monitoreamos la fracción de U (rica en U) y la fracción de U o G (rica en UG) en la misma región de 20 a 40 pares de bases. Los sitios de poliadenilación proximales se enriquecieron en secuencias ricas en U y ricas en UG para genes que cambiaron a un mayor uso de isoformas más largas con quiescencia (Fig. 5e y archivo adicional 1: Figura S8). Este resultado es consistente con la regulación a la baja de CstF-64 que juega un papel en el cambio a sitios de poliadenilación más distales con quiescencia. Por tanto, en condiciones de proliferación, los niveles de CstF-64 están más disponibles para unirse a sitios proximales ricos en U, lo que apoya la generación de isoformas más cortas.

El cambio a sitios de poliadenilación más distales estabiliza las transcripciones en fibroblastos inactivos pero no proliferantes

Los cambios en los niveles de transcripciones que terminan en diferentes sitios de poliadenilación podrían reflejar cambios en las velocidades a las que se generan estas isoformas en función de los niveles de factores de poliadenilación, o cambios en las velocidades a las que decaen. Para comprender la relación entre la selección del sitio de poliadenilación y el destino de la transcripción, primero determinamos si APA con quiescencia estaba asociado con un cambio en la expresión génica. La expresión relativa en reposo en comparación con la proliferación de fibroblastos fue ligeramente mayor en promedio para los genes que experimentan un cambio hacia un mayor uso de sitios de poliadenilación distal con quiescencia que para genes que no se someten a APA o utilizan el sitio de poliadenilación proximal preferentemente en reposo (Fig. 6a, pag & lt 0,001, prueba de rango con signo de Wilcoxon). Este hallazgo sería consistente con que las transcripciones más largas sean más estables.

Mayor expresión y mayor estabilidad para genes que cambian a una mayor dependencia de los sitios de poliadenilación distales en reposo. a Para dos líneas de fibroblastos diferentes (12-1 y 12-3), el registro2(Recuentos de 7dCI / recuentos de proliferación) se representa gráficamente para los genes que cambian a un mayor uso de sitios de poliadenilación más distales con quiescencia y un grupo de control que no cambia a un uso de sitios más distales. Los recuadros indican rangos de 25 a 75% y los bigotes indican valores mínimos y máximos. La significación estadística se determinó con la prueba de rangos con signo de Wilcoxon. La proporción del nivel de expresión en 7dCI frente a P fue mayor para los genes que se desplazan hacia el uso del sitio de poliadenilación más distal con quiescencia para los fibroblastos 12-1 y 12-3. B Se determinaron las semividas de desintegración de transcripciones específicas de isoformas para 12-1 y 12-3 cepas de fibroblastos en condiciones de proliferación y reposo. Los diagramas de caja muestran el rango de semividas de las isoformas que terminan en sitios de poliadenilación proximales e isoformas que terminan en sitios de poliadenilación más distales en condiciones de proliferación y de reposo. Las isoformas largas son significativamente más estables en estados inactivos pero no proliferantes en fibroblastos 12-1 y 12-3. Las diferencias estadísticamente significativas se determinaron mediante la prueba de rango con signo de Wilcoxon. C Gráficos de densidad de vidas medias para isoformas que terminan en sitios de poliadenilación proximales o distales en fibroblastos en proliferación y en reposo de las cepas 12-1 y 12-3

Para comprender mejor la relación entre la selección del sitio de poliadenilación y la tasa de desintegración de la transcripción, agregamos actinomicina D para inhibir la nueva transcripción en fibroblastos en proliferación o 7dCI, recolectamos ARN durante un curso de tiempo y realizamos ARN-Seq enriquecido en el sitio de poliadenilación para monitorear la tasa de ese gen diferente las isoformas decayeron [62]. Los resultados amplían nuestros estudios previos de tasas de desintegración de transcripciones de todo el genoma en fibroblastos en proliferación y 7dCI utilizando microarrays [63]. En dos cepas de fibroblastos diferentes (12-1 y 12-3), encontramos que las isoformas que terminan en los sitios de poliadenilación distal eran más estables que las isoformas que terminan en los sitios de poliadenilación proximales en fibroblastos inactivos, pero no proliferantes (archivo adicional 12 y figura 6b). , C).

Identificamos motivos enriquecidos en las regiones del sitio de interpoliadenilación en genes que cambian a una isoforma más larga con quiescencia. Entre las proteínas de unión al ARN que se unen a estos motivos, algunas se inducen en reposo en comparación con las células en proliferación y serían candidatas para estabilizar transcripciones más largas en células en reposo (archivo adicional 1: Tabla S5). Nuestros hallazgos indican que el cambio al uso de isoformas más largas en células inactivas da como resultado una estabilización general de las transcripciones y un modesto aumento en los niveles de expresión. Por lo tanto, los niveles más altos de isoformas más largas en fibroblastos en reposo que en proliferación podrían reflejar tanto una diferencia en la selección del sitio de poliadenilación (influenciada por los niveles de factores de poliadenilación) como una diferencia en la velocidad a la que decaen las transcripciones más cortas y más largas en los dos estados proliferativos.

Los factores de escisión y poliadenilación se expresan en niveles más altos en la cicatrización de heridas que la piel inactiva in vivo.

La cicatrización de heridas es una situación en la que las células se activan para proliferar y migrar. Investigamos los niveles de factores de escisión y poliadenilación en piel normal y en heridas de escisión dérmica en ratones. Introducimos biopsias por sacabocados en la espalda de los ratones y recolectamos tejido herido y piel de control no herida aproximadamente a 2 cm de la herida. La inmunohistoquímica para el marcador de proliferación Ki-67 reveló niveles más altos de proliferación de una masa de células migratorias que incluye fibroblastos, miofibroblastos y células inmunes en la piel proximal a la herida en comparación con las células de la dermis de control, piel sana (Fig.7 ) [64]. La inmunotinción para la histona H4 como control reveló una tinción similar en la piel herida y de control como se esperaba. La inmunohistoquímica para CstF-64, CPSF73 o CFIm25 reveló una mayor fracción de células con núcleos positivos en la región que rodea la piel lesionada para los tres factores que en la piel de control no lesionada (Fig. 7). Este análisis reveló que el cambio hacia niveles más altos de factores de escisión y poliadenilación en la proliferación de fibroblastos en cultivo también se produce en las células migratorias en proliferación que curan las heridas in vivo.

Los factores de escisión y poliadenilación se expresan a niveles más altos en los fibroblastos cercanos a una herida que en los fibroblastos de piel sana. Se recogió piel de ratón 5 días después de la introducción de una biopsia por sacabocados. Se recogió piel normal de ratón a 2 cm de la herida. Las muestras se tiñeron con inmunohistoquímica para el marcador de proliferación Ki-67, histona H4 como control o factores alternativos de poliadenilación y escisión CstF-64, CPSF73 o CFIm25 (marrón). Las muestras analizadas con inmunohistoquímica se contratiñeron con hematoxilina (núcleos azules). A las células individuales en diferentes posiciones de las heridas se les asignó tinción positiva o negativa y se muestran los porcentajes. Ki-67 no etiqueta todas las células en división y probablemente subestima la fracción de células que están ciclando activamente [122]. Los niveles de los tres factores de escisión y poliadenilación fueron más altos en los fibroblastos, miofibroblastos y células inmunes proximales a una herida que en las áreas dérmicas ricas en fibroblastos de la piel sana distal a la herida.

La eliminación de CstF-64 reduce la migración de fibroblastos

Basándonos en la consistencia con la que observamos cambios en el procesamiento de ARNm y la expresión de genes importantes para la motilidad celular en fibroblastos en proliferación versus quiescentes (Tabla 1), planteamos la hipótesis de que los cambios en el procesamiento de ARNm asociados con la transición entre proliferación y quiescencia también son importantes para el proceso de migración celular estrechamente vinculado. Primero probamos la asociación entre proliferación y migración. Generamos fibroblastos que estaban proliferando, inducidos en quiescencia por 7dSS, o reestimulados después de 7dSS por re-adición de medio con suero. Monitoreamos la velocidad a la que los fibroblastos en cada condición migraron a un área denudada en una placa de cultivo de tejidos con imágenes en tiempo real (Fig. 8a). La migración se cuantificó como la relación entre la concentración de células en el área sin desnudar en comparación con la concentración de células en el área sin desnudar, normalizando así las posibles diferencias en la tasa de proliferación. Descubrimos que los fibroblastos proliferantes y reestimulados migraban hacia el área denudada más rápidamente que los fibroblastos privados de suero (Fig. 8b).

La eliminación de los factores APA da como resultado una reducción de la migración. a Ejemplo de ensayo de migración de Incucyte. Se muestran imágenes de campo claro de un ensayo que monitorea la tasa de migración a un área denudada (marcada con una flecha doble) realizada con imágenes en tiempo real de Incucyte. B Los fibroblastos en proliferación migran más rápidamente a un área denudada que los fibroblastos inactivos. Se tomaron muestras de fibroblastos en condiciones de proliferación, condiciones de 7dSS (7dSS) o después de 7dSS seguido de reestimulación del suero (7dSS-R). Los fibroblastos se sembraron en placas de 96 pocillos y una parte del pocillo se despojó de células. Las placas se analizaron con un instrumento de formación de imágenes en tiempo real Incucyte y el software asociado para controlar la velocidad a la que los fibroblastos migraron al área denudada. Se representa gráficamente la relación entre la densidad celular en el área denotada y el área no desnuda (densidad relativa de la herida) a lo largo de un transcurso de tiempo. Se monitorearon seis pozos para cada condición y los datos representan la desviación estándar y media. Proliferación frente a muestras de 7 dSS (pag valor & lt 0,001, ANOVA bidireccional de medidas repetidas con la prueba de comparación múltiple de Dunnett), muestras proliferantes versus muestras reestimuladas con 7dSS (pag valor & lt 0,001) y 7dSS frente a 7dSS-R (pag value & lt 0.001) fueron estadísticamente significativamente diferentes. C Inmunotransferencias que demuestran la eliminación del factor de poliadenilación y escisión dirigida por ARNip en fibroblastos. También se muestra el porcentaje de reducción del nivel de proteínas. D La eliminación de CstF-64 reduce la migración de fibroblastos. Los fibroblastos se transfectaron con un ARNip de control o un ARNip contra CFIm25, CstF-64 o CPSF73. Los fibroblastos de eliminación de CstF-64 mostraron una migración reducida a un área denudada que los fibroblastos de control (CstF64.1 pag valor = 0,0013). Dos ARNip adicionales contra CstF-64 (CstF64.2 y CstF64.3) redujeron la migración en comparación con un ARNip de control emparejado también (CstF64.2 pag valor = 0,0021, CstF-64,3 pag valor = 0,0384). Se realizaron seis réplicas para cada condición. mi La eliminación de CstF-64 o CPSF73 redujo la migración de células de cáncer de mama triple negativo. La línea celular de cáncer de mama triple negativo MDA-MB-231 se transfectó con un ARNip de control o un ARNip contra CstF-64, CPSF73 o CFIm25. La migración a un área desnuda de la placa se controló con un instrumento Incucyte. La eliminación de CstF-64 o CPSF73 dio como resultado una migración reducida (CstF64 pag valor = 0.0002, CPSF73 pag valor = 0,0013). Para todas las condiciones, el número de repeticiones para cada condición fue de 6. F Diagrama esquemático que muestra factores de escisión y poliadenilación elevados en fibroblastos en el entorno de cicatrización de heridas. Se espera que el aumento de la expresión de CstF-64, CPSF73 y CFIm25 en fibroblastos en heridas resulte en un mayor uso de sitios de poliadenilación proximales y puede promover la migración de fibroblastos a la herida

Observamos cambios en los niveles de transcripción y proteína de los factores de escisión y poliadenilación a medida que los fibroblastos hacen la transición entre la proliferación y la quiescencia. Para probar si los niveles de factores de escisión y poliadenilación cambian en los fibroblastos inducidos a migrar a un área desnuda, introdujimos áreas desnudas en cultivos de fibroblastos y realizamos inmunofluorescencia para controlar los niveles de factores de escisión y poliadenilación. Los niveles de CstF-64 y CPSF73 fueron significativamente más altos en las células que habían migrado al área denudada que en las células que no habían migrado, mientras que no se observaron cambios significativos para CFIm25 (archivo adicional 1: Figura S9). Luego probamos la importancia de factores de poliadenilación alternativos para la motilidad de los fibroblastos. Generamos fibroblastos knockdown con control de ARNip o ARNip contra factores de escisión y poliadenilación, y monitoreamos la tasa de migración. La eliminación de CstF-64 con cualquiera de los tres ARNip diferentes (Fig. 8c) dio como resultado una migración reducida al área denudada (Fig. 8d). CstF-64 siRNA # 1 tuvo el efecto más fuerte sobre los niveles de CstF-64 y resultó en la reducción más significativa en la migración. La caída de CPSF73 (Fig. 8c) dio como resultado una migración más lenta, pero la diferencia no fue estadísticamente significativa (Fig. 8d). La caída de CFIm25 (Fig. 8c) no afectó la tasa de migración (Fig. 8d). Por lo tanto, CstF-64 se induce en las células que migran y la desactivación de CstF-64 dio como resultado cambios de APA y regulación a la baja de genes que se superponen con los que ocurren con la quiescencia, incluidos los genes asociados con la migración celular (Tabla 3). Estos hallazgos son consistentes con nuestra observación aquí de que la caída de CstF-64 simula la migración reducida observada para fibroblastos inactivos.

La eliminación de los factores de escisión y poliadenilación reduce la migración de células de cáncer de mama triple negativas

Para determinar la generalidad de nuestros hallazgos para diferentes tipos de células, probamos los efectos de los ARNip dirigidos a CstF-64, CPSF73 o CFIm25 en la migración de células de cáncer de mama triple negativo (archivo adicional 1: Figura S3). El cáncer de mama triple negativo es un subtipo de cáncer de mama muy agresivo que se caracteriza por la falta de receptores hormonales y la ausencia de amplificación de HER2 [65]. La eliminación de CstF-64 o CPSF73 dio como resultado una migración significativamente reducida de células de cáncer de mama triple negativas (Fig. 8e). Las células de cáncer de mama triple negativas fueron incluso más sensibles a la selección del sitio de poliadenilación alterada que los fibroblastos, lo que puede reflejar la mayor dependencia de las células cancerosas en los sitios de poliadenilación proximales [20, 45, 46, 66]. Nuestros resultados demuestran que la selección de los sitios de poliadenilación puede afectar la capacidad migratoria de las células cancerosas, así como de los fibroblastos en la cicatrización de heridas (Fig. 8f).


7 CONCLUSIÓN: ¿DÓNDE ESTÁN TODOS LOS FACTORES DE POLIADENILACIÓN ESPECÍFICOS DE LOS TEJIDOS?

La APA específica de tejido es un fenómeno generalizado. Sin embargo, al preparar esta revisión nos sorprendió lo mucho que queda por entender acerca de sus mecanismos. Por ejemplo, sorprendentemente se han descubierto pocas proteínas auxiliares específicas de tejido que controlen APA. Más a menudo, los cambios en los niveles de las proteínas centrales de poliadenilación parecen estar involucrados (CstF-64 y sus variantes o CFImetro) o empalmes con poliadenilación para el control (el interruptor de Ig o Nova en el cerebro). Los mecanismos autenticados para otros ejemplos siguen siendo tentadoramente incompletos.

La conclusión general de esta revisión, que solo hay unos pocos factores auxiliares específicos de tejido que controlan el APA, y que la mayoría de la regulación proviene de niveles alterados de proteínas de poliadenilación centrales, sigue siendo tan cierta hoy como lo fue en 2010, cuando encuestamos originalmente el tema (MacDonald y McMahon, 2010). Los estudios de derribo en líneas celulares han implicado niveles de factores de poliadenilación centrales, como las subunidades de CFI.metro, Fip1 y CPSF. Sin embargo, ha habido solo unas pocas demostraciones de que esos niveles de cualquier proteína de poliadenilación central cambian fisiológicamente en tejidos de metazoos o mamíferos (por ejemplo, Martincic et al., 1998). Curiosamente, algunos estudios concluyen que las proteínas de poliadenilación del núcleo altamente conservadas, como CstF-64, no desempeñan un papel importante en la expresión génica como se pensaba anteriormente (Yao et al., 2012). Sin embargo, los efectos de CstF-64 podrían estar enmascarados en sistemas de mamíferos por la presencia de τCstF-64 (Youngblood et al., 2014), lo que complica las interpretaciones. Los nuevos modelos de APA tendrán que demostrar cambios en los niveles de proteínas de poliadenilación específicas o cambios en la transcripción general del ARNm (alterando la proporción de proteínas de poliadenilación centrales con respecto a los sitios de poliadenilación). Como antes, esperamos el progreso futuro en esta área.


Ver el vídeo: Transcripcion (Febrero 2023).